DEM1 cdna clone
DEM1 cDNA Clone
Gene Names
EXO5; DEM1; Exo V; hExo5; C1orf176
Synonyms
DEM1; DEM1 cDNA Clone; DEM1 cdna clone
Sequence
atggcagagacaagagaagaggagacagtgtcagcagaagcctcagggttctcagacttgagtgactcagagttcctggagtttctggacctagaagatgcccaagagtcaaaggctttagttaacatgcctggcccatcttctgaatcccttgggaaggatgacaaacccataagcttacaaaactggaaaagaggattggatatattatcacccatggagagattccaccttaaatatttatatgtcactgacctggctactcagaactggtgtgaactgcaaacagcatatgggaaggagcttcctggtttcttggcacctgagaaggcagctgtgttggacactggtgccagcatacacctagctagagaactagaacttcatgatcttgtgactgtcccagtcaccactaaagaagatgcttgggcaattaagtttctgaacatacttttgctgattcctaccctgcagtcagaagggcacatcagagagtttccagtgtttggggaagtggagggtgtacttcttgttggagtgattgatgagctgcactatacagccaagggggaactggagctggcggaactcaagacacgcaggcgccctatgctccctctggaagctcagaagaagaaagactgttttcaagtcagcctatacaaatatatctttgatgccatggtacaaggaaaagtgacccctgctagcctaatccaccacacaaagttgtgtctagaaaagccactggggccatcagtgctgaggcatgcccagcagggaggcttctctgtgaagtctttgggtgacctcatggaacttgtcttcttgtctctaacactgtcagacctcccagttattgatatcttgaagattgagtatatccaccaagagactgccactgtgctgggtactgagattgtagccttcaaagagaaggaggtgagagccaaggtgcagcattatatggcctactggatgggccaccgagagccccagggagttgacgtggaggaggcttggaagtgccggacgtgtacctatgcagacatttgtgagtggagaaagggcagtggagtgctcagctctacactggcgccccaagtcaaaaaagccaaatga
Sequence Length
1122
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
41,816 Da
NCBI Official Full Name
Homo sapiens defects in morphology 1 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
exonuclease 5
NCBI Official Symbol
EXO5
NCBI Official Synonym Symbols
DEM1; Exo V; hExo5; C1orf176
NCBI Protein Information
exonuclease V
UniProt Protein Name
Exonuclease V
UniProt Gene Name
EXO5
UniProt Synonym Gene Names
C1orf176; DEM1; Exo V; hExo5
UniProt Entry Name
EXO5_HUMAN
Uniprot Description
DEM1: Probable single strand DNA specific 5' exonuclease mitochondrial DNA replication and recombination. Belongs to the EXO5 family.
Protein type: EC 3.1.11.-
Chromosomal Location of Human Ortholog: 1p34.2
Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus
Molecular Function: 4 iron, 4 sulfur cluster binding; protein homodimerization activity; single-stranded DNA specific 3'-5' exodeoxyribonuclease activity; single-stranded DNA specific 5'-3' exodeoxyribonuclease activity
Research Articles on DEM1
Similar Products
Product Notes
The DEM1 exo5 (Catalog #AAA1265685) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagaga caagagaaga ggagacagtg tcagcagaag cctcagggtt ctcagacttg agtgactcag agttcctgga gtttctggac ctagaagatg cccaagagtc aaaggcttta gttaacatgc ctggcccatc ttctgaatcc cttgggaagg atgacaaacc cataagctta caaaactgga aaagaggatt ggatatatta tcacccatgg agagattcca ccttaaatat ttatatgtca ctgacctggc tactcagaac tggtgtgaac tgcaaacagc atatgggaag gagcttcctg gtttcttggc acctgagaag gcagctgtgt tggacactgg tgccagcata cacctagcta gagaactaga acttcatgat cttgtgactg tcccagtcac cactaaagaa gatgcttggg caattaagtt tctgaacata cttttgctga ttcctaccct gcagtcagaa gggcacatca gagagtttcc agtgtttggg gaagtggagg gtgtacttct tgttggagtg attgatgagc tgcactatac agccaagggg gaactggagc tggcggaact caagacacgc aggcgcccta tgctccctct ggaagctcag aagaagaaag actgttttca agtcagccta tacaaatata tctttgatgc catggtacaa ggaaaagtga cccctgctag cctaatccac cacacaaagt tgtgtctaga aaagccactg gggccatcag tgctgaggca tgcccagcag ggaggcttct ctgtgaagtc tttgggtgac ctcatggaac ttgtcttctt gtctctaaca ctgtcagacc tcccagttat tgatatcttg aagattgagt atatccacca agagactgcc actgtgctgg gtactgagat tgtagccttc aaagagaagg aggtgagagc caaggtgcag cattatatgg cctactggat gggccaccga gagccccagg gagttgacgt ggaggaggct tggaagtgcc ggacgtgtac ctatgcagac atttgtgagt ggagaaaggg cagtggagtg ctcagctcta cactggcgcc ccaagtcaaa aaagccaaat ga. It is sometimes possible for the material contained within the vial of "DEM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
