DDX60 cdna clone
DDX60 cDNA Clone
Synonyms
DDX60; DDX60 cDNA Clone; DDX60 cdna clone
Sequence
atgaaaattatggaggactttaccactttcctacgaattgtttccaaactggctgatatgaatcaggaatatcaactcccattgtcaaaaatcaaattcacaggtaaagaatgtgaagactctcaactcgtatctcatttgatgagctgcaaggaaggaagagtagcaatttcaccatttgtttgtctgtctgggaactttgatgatgatttgcttcgactagaaactccaaaccatgttactctaggcacaatcggtgtcaatcgctctcaggctccagtgctgttgtcacagaaatttgataaccgaggaaggaaaatgtcgcttaatgcctatgcactggatttctacaaacatggttccttgataggattagtccaggataacaggatgaatgaaggagatgcttattatttgttgaaggattttgcactcaccattaaatctatcagtgtttccttgcgtgagctatgtgaaaatgaagacgacaacgttgtcttagcctttgaacaactgagtacaactttttgggaaaagttaaacaaagtctaa
Sequence Length
552
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
197,853 Da
NCBI Official Full Name
Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 60, mRNA
NCBI Official Synonym Full Names
DEXD/H-box helicase 60
NCBI Official Symbol
DDX60
NCBI Protein Information
probable ATP-dependent RNA helicase DDX60
UniProt Protein Name
Probable ATP-dependent RNA helicase DDX60
Protein Family
UniProt Gene Name
DDX60
UniProt Entry Name
DDX60_HUMAN
Uniprot Description
DDX60: Positively regulates DDX58/RIG-I- and IFIH1/MDA5- dependent type I interferon and interferon inducible gene expression in response to viral infection. Binds ssRNA, dsRNA and dsDNA and can promote the binding of DDX58/RIG-I to dsRNA. Exhibits antiviral activity against hepatitis C virus and vesicular stomatitis virus (VSV). Belongs to the helicase family.
Protein type: EC 3.6.4.13; Hydrolase
Chromosomal Location of Human Ortholog: 4q32.3
Cellular Component: cytoplasm; intermediate filament cytoskeleton
Molecular Function: double-stranded DNA binding; double-stranded RNA binding; protein binding; single-stranded RNA binding
Biological Process: response to virus
Research Articles on DDX60
Similar Products
Product Notes
The DDX60 ddx60 (Catalog #AAA1276815) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaaatta tggaggactt taccactttc ctacgaattg tttccaaact ggctgatatg aatcaggaat atcaactccc attgtcaaaa atcaaattca caggtaaaga atgtgaagac tctcaactcg tatctcattt gatgagctgc aaggaaggaa gagtagcaat ttcaccattt gtttgtctgt ctgggaactt tgatgatgat ttgcttcgac tagaaactcc aaaccatgtt actctaggca caatcggtgt caatcgctct caggctccag tgctgttgtc acagaaattt gataaccgag gaaggaaaat gtcgcttaat gcctatgcac tggatttcta caaacatggt tccttgatag gattagtcca ggataacagg atgaatgaag gagatgctta ttatttgttg aaggattttg cactcaccat taaatctatc agtgtttcct tgcgtgagct atgtgaaaat gaagacgaca acgttgtctt agcctttgaa caactgagta caactttttg ggaaaagtta aacaaagtct aa. It is sometimes possible for the material contained within the vial of "DDX60, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
