Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

Testing Data (MAP)

NRP2 cdna clone

NRP2 cDNA Clone

Gene Names
NRP2; NP2; NPN2; PRO2714; VEGF165R2
Synonyms
NRP2; NRP2 cDNA Clone; NRP2 cdna clone
Ordering
For Research Use Only!
Sequence
ATGGATATGTTTCCTCTCACCTGGGTTTTCTTAGCCCTCTACTTTTCAAGACACCAAGTGAGAGGCCAACCAGACCCACCGTGCGGAGGTCGTTTGAATTCCAAAGATGCTGGCTATATCACCTCTCCCGGTTACCCCCAGGACTACCCCTCCCACCAGAACTGCGAGTGGATTGTTTACGCCCCCGAACCCAACCAGAAGATTGTCCTCAACTTCAACCCTCACTTTGAAATCGAGAAGCACGACTGCAACTTGCTGTCTGCTTGGAAAATTTCACTCACAAGCCGCAGCTTTGCCTGA
Sequence Length
300
cDNA Size
300 bp
Definition
Homo sapiens neuropilin 2, mRNA (cDNA clone IMAGE:3928418), complete cds.
recombination site
attL1, attL2
Vector
pENTR223.1?spectinomycin?

Testing Data

(MAP)

Testing Data (MAP)

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
62,458 Da
NCBI Official Full Name
Homo sapiens neuropilin 2, mRNA
NCBI Official Synonym Full Names
neuropilin 2
NCBI Official Symbol
NRP2
NCBI Official Synonym Symbols
NP2; NPN2; PRO2714; VEGF165R2
NCBI Protein Information
neuropilin-2
UniProt Protein Name
Neuropilin-2
Protein Family
UniProt Gene Name
NRP2
UniProt Synonym Gene Names
VEGF165R2
UniProt Entry Name
NRP2_HUMAN

NCBI Description

This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

NRP2: High affinity receptor for semaphorins 3C, 3F, VEGF-165 and VEGF-145 isoforms of VEGF, and the PLGF-2 isoform of PGF. Heterodimer with NRP1. Binds PLXNB1. Belongs to the neuropilin family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Membrane protein, integral; Receptor, misc.

Chromosomal Location of Human Ortholog: 2q33.3

Cellular Component: membrane; plasma membrane

Molecular Function: growth factor binding; receptor activity

Biological Process: axon extension involved in axon guidance; nerve development; positive regulation of endothelial cell proliferation; vascular endothelial growth factor receptor signaling pathway

Research Articles on NRP2

Similar Products

Product Notes

The NRP2 nrp2 (Catalog #AAA1272415) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGATATGT TTCCTCTCAC CTGGGTTTTC TTAGCCCTCT ACTTTTCAAG ACACCAAGTG AGAGGCCAAC CAGACCCACC GTGCGGAGGT CGTTTGAATT CCAAAGATGC TGGCTATATC ACCTCTCCCG GTTACCCCCA GGACTACCCC TCCCACCAGA ACTGCGAGTG GATTGTTTAC GCCCCCGAAC CCAACCAGAA GATTGTCCTC AACTTCAACC CTCACTTTGA AATCGAGAAG CACGACTGCA ACTTGCTGTC TGCTTGGAAA ATTTCACTCA CAAGCCGCAG CTTTGCCTGA. It is sometimes possible for the material contained within the vial of "NRP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.