Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DBH cdna clone

DBH cDNA Clone

Gene Names
DBH; DBM
Synonyms
DBH; DBH cDNA Clone; DBH cdna clone
Ordering
For Research Use Only!
Sequence
atgcgggaggcagccttcatgtacagcacagcagtggccatcttcctggtcatcctggtggccgcactgcagggctcggctccccgtgagagccccctcccctatcacatccccctggacccggaggggtccctggagctctcatggaatgtcagctacacccaggaggccatccatttccagctcctggtgcggaggctcaaggctggcgtcctgtttgggatgtccgaccgtggcgagcttgagaacgcagatctcgtggtgctctggaccgatggggacactgcctattttgcggacgcctggagtgaccagaaggggcagatccacctggatccccagcaggactaccagctgctgcaggtgcagaggaccccagaaggcctgaccctgcttttcaagaggccctttggcacctgcgaccccaaggattacctcattgaggacggcactgtccacttggtctacgggatcctggaggagccgttccggtcactggaggccatcaacggctcgggcctgcagatggggctgcagagggtgcagctcctgaagcccaatatccccgaaccggagttgccctcagacgcgtgcaccatggaggtccaagctcccaatatccagatccccagccaggagaccacgtactggtgctacattaaggagcttccaaagggcttctctcggcaccacattatcaagtacgagcccatcgtcaccaagggcaatgaggcccttgtccaccacatggaagtcttccagtgcgcccccgagatggacagcgtcccccacttcagcgggccctgcgactccaagatgaaacccgaccgcctcaactactgccgccacgtgctggccgcctgggccctgggtgccaaggcattttactacccagaggaagccggccttgccttcgggggtccagggtcctccagatatctccgcctggaagttcactaccacaacccactggtgatagaaggacgaaacgactcctcaggcatccgcttgtactacacagccaagctgcggcgcttcaacgcggggatcatggagctgggactggtgtacacgccagtgatggccattccaccacgggagaccgccttcatcctcactggctactgcacggacaagtgcacccagctggcactgcctccctccgggatccacatcttcgcctctcagctccacacacacctgactgggagaaaggtggtcacagtgctggtccgggacggccgggagtgggagatcgtgaaccaggacaatcactacagccctcacttccaggagatccgcatgttgaagaaggtcgtgtcggtccatccgggagatgtgctcatcacctcctgcacgtacaacacggaagaccgggagctggccacagtggggggcttcgggatcctggaggagatgtgtgtcaactacgtgcactactacccccagacgcagctggagctctgcaagagcgctgtggacgccggcttcctgcagaagtacttccacctcatcaacaggttcaacaacgaggatgtctgcacctgccctcaggcgtccgtgtctcagcagttcacctctgttccctggaactccttcaaccgcgacgtactgaaggccctgtacagcttcgcgcccatctccatgcactgcaacaagtcctcagccgtccgcttccagggtgaatggaacctgcagcccctgcccaaggtcatctccacactggaagagcccaccccacagtgccccaccagccagggccgaagccctgctggccccaccgttgtcagcattggtgggggcaaaggctga
Sequence Length
1812
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
69,065 Da
NCBI Official Full Name
Homo sapiens dopamine beta-hydroxylase (dopamine beta-monooxygenase), mRNA
NCBI Official Synonym Full Names
dopamine beta-hydroxylase
NCBI Official Symbol
DBH
NCBI Official Synonym Symbols
DBM
NCBI Protein Information
dopamine beta-hydroxylase
UniProt Protein Name
Dopamine beta-hydroxylase
Protein Family
UniProt Gene Name
DBH
UniProt Entry Name
DOPO_HUMAN

NCBI Description

The protein encoded by this gene is an oxidoreductase belonging to the copper type II, ascorbate-dependent monooxygenase family. It is present in the synaptic vesicles of postganglionic sympathetic neurons and converts dopamine to norepinephrine. It exists in both soluble and membrane-bound forms, depending on the absence or presence, respectively, of a signal peptide. [provided by RefSeq, Jul 2008]

Uniprot Description

DBH: Conversion of dopamine to noradrenaline. Homotetramer composed of two non-covalently bound disulfide-linked dimers. Activity is enhanced by nerve growth factor (in superior cervical ganglia and adrenal medulla). Trans-synaptic stimulation with reserpine, acetylcholine and glucocorticoids. Belongs to the copper type II ascorbate-dependent monooxygenase family.

Protein type: Amino Acid Metabolism - tyrosine; Cell cycle regulation; Membrane protein, integral; EC 1.14.17.1; Motility/polarity/chemotaxis; Apoptosis; Oxidoreductase

Chromosomal Location of Human Ortholog: 9q34

Cellular Component: cytoplasm; extracellular space; membrane; secretory granule membrane

Molecular Function: catalytic activity; copper ion binding; dopamine beta-monooxygenase activity

Biological Process: catecholamine biosynthetic process; dopamine catabolic process; norepinephrine biosynthetic process; synaptic transmission

Disease: Dopamine Beta-hydroxylase Deficiency, Congenital

Research Articles on DBH

Similar Products

Product Notes

The DBH dbh (Catalog #AAA1270472) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgggagg cagccttcat gtacagcaca gcagtggcca tcttcctggt catcctggtg gccgcactgc agggctcggc tccccgtgag agccccctcc cctatcacat ccccctggac ccggaggggt ccctggagct ctcatggaat gtcagctaca cccaggaggc catccatttc cagctcctgg tgcggaggct caaggctggc gtcctgtttg ggatgtccga ccgtggcgag cttgagaacg cagatctcgt ggtgctctgg accgatgggg acactgccta ttttgcggac gcctggagtg accagaaggg gcagatccac ctggatcccc agcaggacta ccagctgctg caggtgcaga ggaccccaga aggcctgacc ctgcttttca agaggccctt tggcacctgc gaccccaagg attacctcat tgaggacggc actgtccact tggtctacgg gatcctggag gagccgttcc ggtcactgga ggccatcaac ggctcgggcc tgcagatggg gctgcagagg gtgcagctcc tgaagcccaa tatccccgaa ccggagttgc cctcagacgc gtgcaccatg gaggtccaag ctcccaatat ccagatcccc agccaggaga ccacgtactg gtgctacatt aaggagcttc caaagggctt ctctcggcac cacattatca agtacgagcc catcgtcacc aagggcaatg aggcccttgt ccaccacatg gaagtcttcc agtgcgcccc cgagatggac agcgtccccc acttcagcgg gccctgcgac tccaagatga aacccgaccg cctcaactac tgccgccacg tgctggccgc ctgggccctg ggtgccaagg cattttacta cccagaggaa gccggccttg ccttcggggg tccagggtcc tccagatatc tccgcctgga agttcactac cacaacccac tggtgataga aggacgaaac gactcctcag gcatccgctt gtactacaca gccaagctgc ggcgcttcaa cgcggggatc atggagctgg gactggtgta cacgccagtg atggccattc caccacggga gaccgccttc atcctcactg gctactgcac ggacaagtgc acccagctgg cactgcctcc ctccgggatc cacatcttcg cctctcagct ccacacacac ctgactggga gaaaggtggt cacagtgctg gtccgggacg gccgggagtg ggagatcgtg aaccaggaca atcactacag ccctcacttc caggagatcc gcatgttgaa gaaggtcgtg tcggtccatc cgggagatgt gctcatcacc tcctgcacgt acaacacgga agaccgggag ctggccacag tggggggctt cgggatcctg gaggagatgt gtgtcaacta cgtgcactac tacccccaga cgcagctgga gctctgcaag agcgctgtgg acgccggctt cctgcagaag tacttccacc tcatcaacag gttcaacaac gaggatgtct gcacctgccc tcaggcgtcc gtgtctcagc agttcacctc tgttccctgg aactccttca accgcgacgt actgaaggcc ctgtacagct tcgcgcccat ctccatgcac tgcaacaagt cctcagccgt ccgcttccag ggtgaatgga acctgcagcc cctgcccaag gtcatctcca cactggaaga gcccacccca cagtgcccca ccagccaggg ccgaagccct gctggcccca ccgttgtcag cattggtggg ggcaaaggct ga. It is sometimes possible for the material contained within the vial of "DBH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.