Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COG7 cdna clone

COG7 cDNA Clone

Gene Names
COG7; CDG2E
Synonyms
COG7; COG7 cDNA Clone; COG7 cdna clone
Ordering
For Research Use Only!
Sequence
atggacttctccaagttcctggcagacgacttcgacgtgaaggagtggatcaatgcggccttcagggccggctccaaggaggcggcgtccgggaaggcggatggccacgcagccaccctggtgatgaagctgcagctgttcatccaagaggtgaaccacgccgtggaggaaacaagtcaccaagctctccagaacatgcccaaagtgctccgtgatgttgaagccctaaaacaggaggcatctttcctgaaagaacagatgattcttgtcaaggaggacattaaaaaatttgaacaggacacatctcaatccatgcaggtgttggtagaaattgaccaagtgaagtccagaatgcaacttgctgccgaatctcttcaggaagcagataagtggagcacgttgagcgccgatattgaggagacatttaagactcaggacatagctgtgatttctgccaagctaacaggtatgcagaacagcttaatgatgcttgttgatacaccagactactcagaaaagtgtgtgcacttggaggcactgaagaacaggctggaggccctagccagtccacagattgtagcggcattcacctctcaggctgtagatcagtccaaagtgtttgtgaaggtgtttactgaaattgaccggatgccccagctcctggcctactactacaagtgtcacaaggtgcagcttttagcagcctggcaagagctgtgtcaaagtgacctatccctggaccggcagcttaccggactctatgatgccttgcttggtgcttggcacacacaaatccagtgggctacacaggttttccagaagccccacgaggtggtaatggtgctgctgattcagaccctgggggccctcatgccctcgctgccctcctgcctcagcaacggcgtggagagggcagggcccgagcaggagctcaccaggctgctggagttctacgacgccaccgcccacttcgccaagggcttggagatggcactgctcccccacctacatgaacacaatctggtaaaagtcacggagctggtggatgctgtgtatgatccatacaaaccctaccagctgaagtatggcgacatggaagagagcaacctcctcatccagatgagtgctgtgcctctggagcatggggaagtgattgactgtgtgcaggagctgagccactccgtgaacaagctgtttggtctggcgtctgcagccgttgacagatgcgtcagattcaccaatggcctggggacctgcggcctgttgtcagccctgaaatccctctttgccaagtatgtgtctgatttcaccagcactctccagtccatacgaaagaagtgcaaactggaccacattcctcccaactccctcttccaggaagattggacggcttttcagaactccattaggataatagccacctgtggagagcttttgcggcattgtggggacttcgagcagcagctagccaacaggattttgtccacagctgggaagtatctatctgattcctgcagcccccggagcctggctggttttcaggagagcatcttgacagacaagaagaactctgccaagaacccatggcaagaatataattacctccagaaagataaccctgctgaatatgccagtttaatggaaatactttatacccttaaggaaaaagggtcaagcaaccacaacctgctggctgcacctcgagcagcgctgactcggcttaaccagcaggcccaccagctggctttcgattccgtgttcctgcgcatcaaacaacagctgttgcttatttcgaagatggacagctggaatacggctggcatcggagaaaccctcacagatgaactgcccgcctttagtctcacccctctcgagtacatcagcaacatcgggcagtacatcatgtccctccccctgaatcttgagccatttgtgactcaggaggactctgccttagagttggcattgcacgctggaaagctgccatttcctcctgagcagggggatgaattgcccgagctggacaacatggctgacaactggctgggctcgatcgccagagccacaatgcagacctactgtgatgcgatcctacagatccctgagctgagcccacactctgccaagcagctggccactgacatcgactatctgatcaacgtgatggatgccctgggcctgcagccgtcccgcaccctccagcacatcgtgacgctactgaagaccaggcctgaggactatagacaggtcagcaaaggcctgccccgtcgcctggccaccaccgtggccaccatgcggagtgtgaattactga
Sequence Length
2313
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
86,344 Da
NCBI Official Full Name
Homo sapiens component of oligomeric golgi complex 7, mRNA
NCBI Official Synonym Full Names
component of oligomeric golgi complex 7
NCBI Official Symbol
COG7
NCBI Official Synonym Symbols
CDG2E
NCBI Protein Information
conserved oligomeric Golgi complex subunit 7
UniProt Protein Name
Conserved oligomeric Golgi complex subunit 7
UniProt Gene Name
COG7
UniProt Synonym Gene Names
COG complex subunit 7
UniProt Entry Name
COG7_HUMAN

NCBI Description

The protein encoded by this gene resides in the golgi, and constitutes one of the 8 subunits of the conserved oligomeric Golgi (COG) complex, which is required for normal golgi morphology and localization. Mutations in this gene are associated with the congenital disorder of glycosylation type IIe.[provided by RefSeq, May 2010]

Uniprot Description

COG7: Required for normal Golgi function. Defects in COG7 are the cause of congenital disorder of glycosylation type 2E (CDG2E). CDGs are a family of severe inherited diseases caused by a defect in protein N- glycosylation. They are characterized by under-glycosylated serum proteins. These multisystem disorders present with a wide variety of clinical features, such as disorders of the nervous system development, psychomotor retardation, dysmorphic features, hypotonia, coagulation disorders, and immunodeficiency. The broad spectrum of features reflects the critical role of N-glycoproteins during embryonic development, differentiation, and maintenance of cell functions. Belongs to the COG7 family.

Chromosomal Location of Human Ortholog: 16p12.2

Cellular Component: Golgi apparatus; Golgi membrane; Golgi transport complex; intracellular membrane-bound organelle; nucleolus; trans-Golgi network membrane

Molecular Function: protein binding

Biological Process: ER to Golgi vesicle-mediated transport; Golgi organization and biogenesis; intracellular protein transport; protein amino acid glycosylation; protein localization in Golgi apparatus; protein localization in organelle; protein stabilization; retrograde vesicle-mediated transport, Golgi to ER

Disease: Congenital Disorder Of Glycosylation, Type Iie

Research Articles on COG7

Similar Products

Product Notes

The COG7 cog7 (Catalog #AAA1278262) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacttct ccaagttcct ggcagacgac ttcgacgtga aggagtggat caatgcggcc ttcagggccg gctccaagga ggcggcgtcc gggaaggcgg atggccacgc agccaccctg gtgatgaagc tgcagctgtt catccaagag gtgaaccacg ccgtggagga aacaagtcac caagctctcc agaacatgcc caaagtgctc cgtgatgttg aagccctaaa acaggaggca tctttcctga aagaacagat gattcttgtc aaggaggaca ttaaaaaatt tgaacaggac acatctcaat ccatgcaggt gttggtagaa attgaccaag tgaagtccag aatgcaactt gctgccgaat ctcttcagga agcagataag tggagcacgt tgagcgccga tattgaggag acatttaaga ctcaggacat agctgtgatt tctgccaagc taacaggtat gcagaacagc ttaatgatgc ttgttgatac accagactac tcagaaaagt gtgtgcactt ggaggcactg aagaacaggc tggaggccct agccagtcca cagattgtag cggcattcac ctctcaggct gtagatcagt ccaaagtgtt tgtgaaggtg tttactgaaa ttgaccggat gccccagctc ctggcctact actacaagtg tcacaaggtg cagcttttag cagcctggca agagctgtgt caaagtgacc tatccctgga ccggcagctt accggactct atgatgcctt gcttggtgct tggcacacac aaatccagtg ggctacacag gttttccaga agccccacga ggtggtaatg gtgctgctga ttcagaccct gggggccctc atgccctcgc tgccctcctg cctcagcaac ggcgtggaga gggcagggcc cgagcaggag ctcaccaggc tgctggagtt ctacgacgcc accgcccact tcgccaaggg cttggagatg gcactgctcc cccacctaca tgaacacaat ctggtaaaag tcacggagct ggtggatgct gtgtatgatc catacaaacc ctaccagctg aagtatggcg acatggaaga gagcaacctc ctcatccaga tgagtgctgt gcctctggag catggggaag tgattgactg tgtgcaggag ctgagccact ccgtgaacaa gctgtttggt ctggcgtctg cagccgttga cagatgcgtc agattcacca atggcctggg gacctgcggc ctgttgtcag ccctgaaatc cctctttgcc aagtatgtgt ctgatttcac cagcactctc cagtccatac gaaagaagtg caaactggac cacattcctc ccaactccct cttccaggaa gattggacgg cttttcagaa ctccattagg ataatagcca cctgtggaga gcttttgcgg cattgtgggg acttcgagca gcagctagcc aacaggattt tgtccacagc tgggaagtat ctatctgatt cctgcagccc ccggagcctg gctggttttc aggagagcat cttgacagac aagaagaact ctgccaagaa cccatggcaa gaatataatt acctccagaa agataaccct gctgaatatg ccagtttaat ggaaatactt tataccctta aggaaaaagg gtcaagcaac cacaacctgc tggctgcacc tcgagcagcg ctgactcggc ttaaccagca ggcccaccag ctggctttcg attccgtgtt cctgcgcatc aaacaacagc tgttgcttat ttcgaagatg gacagctgga atacggctgg catcggagaa accctcacag atgaactgcc cgcctttagt ctcacccctc tcgagtacat cagcaacatc gggcagtaca tcatgtccct ccccctgaat cttgagccat ttgtgactca ggaggactct gccttagagt tggcattgca cgctggaaag ctgccatttc ctcctgagca gggggatgaa ttgcccgagc tggacaacat ggctgacaac tggctgggct cgatcgccag agccacaatg cagacctact gtgatgcgat cctacagatc cctgagctga gcccacactc tgccaagcag ctggccactg acatcgacta tctgatcaac gtgatggatg ccctgggcct gcagccgtcc cgcaccctcc agcacatcgt gacgctactg aagaccaggc ctgaggacta tagacaggtc agcaaaggcc tgccccgtcg cctggccacc accgtggcca ccatgcggag tgtgaattac tga. It is sometimes possible for the material contained within the vial of "COG7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.