Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CLEC11A cdna clone

CLEC11A cDNA Clone

Gene Names
CLEC11A; P47; SCGF; LSLCL; CLECSF3
Synonyms
CLEC11A; CLEC11A cDNA Clone; CLEC11A cdna clone
Ordering
For Research Use Only!
Sequence
atgcaggcagcctggcttttgggggctttggtggtcccccagctcttgggctttggccatggggctcggggagcagagagggagtgggagggaggctggggaggtgcccaggaggaggagcgggagagggaggccctgatgctgaagcatctgcaggaagccctaggactgcctgctgggaggggggatgagaatcctgccggaactgttgagggaaaagaggactgggagatggaggaggaccagggggaggaagaggaggaggaagcaacgccaaccccatcctccggccccagcccctctcccacccctgaggacatcgtcacttacatcctgggccgcctggccggcctggacgcaggcctgcaccagctgcacgtccgtctgcacgcgttggacacccgcgtggtcgagctgacccaggggctgcggcagctgcggaacgcggcaggcgacacccgcgatgccgtgcaagccctgcaggaggcgcagggtcgcgccgagcgcgagcacggccgcttggagggctgcctgaaggggctgcgcctgggccacaagtgcttcctgctctcgcgcgacttcgaagctcaggcggcggcgcaggcgcggtgcacggcgcggggcgggagcctggcgcagccggcagaccgccagcagatggaggcgctcactcggtacctgcgcgcggcgctcgctccctacaactggcccgtgtggctgggcgtgcacgatcggcgcgccgagggcctctacctcttcgaaaacggccagcgcgtgtccttcttcgcctggcatcgctcaccccgccccgagctcggcgcccagcccagcgcctcgccgcatccgctcagcccggaccagcccaacggtggcacgctcgagaactgcgtggcgcaggcctctgacgacggctcctggtgggaccacgactgccagcggcgtctctactacgtctgcgagttccccttctag
Sequence Length
972
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,695 Da
NCBI Official Full Name
Homo sapiens C-type lectin domain family 11, member A, mRNA
NCBI Official Synonym Full Names
C-type lectin domain family 11 member A
NCBI Official Symbol
CLEC11A
NCBI Official Synonym Symbols
P47; SCGF; LSLCL; CLECSF3
NCBI Protein Information
C-type lectin domain family 11 member A
UniProt Protein Name
C-type lectin domain family 11 member A
UniProt Gene Name
CLEC11A
UniProt Synonym Gene Names
CLECSF3; LSLCL; SCGF
UniProt Entry Name
CLC11_HUMAN

NCBI Description

This gene encodes a member of the C-type lectin superfamily. The encoded protein is a secreted sulfated glycoprotein and functions as a growth factor for primitive hematopoietic progenitor cells. An alternative splice variant has been described but its biological nature has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

CLEC11A: Stimulates the proliferation and differentiation of hematopoietic precursor cells from various lineages, including erythrocytes, lymphocytes, granulocytes and macrophages. Acts synergistically with other cytokines, including IL-3, GCSF, GMCSF and FLT3 ligand. Suppresses SCF-stimulated erythrocyte proliferation.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 19q13.3

Cellular Component: extracellular region; extracellular space

Molecular Function: growth factor activity

Biological Process: positive regulation of cell proliferation

Research Articles on CLEC11A

Similar Products

Product Notes

The CLEC11A clec11a (Catalog #AAA1272286) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggcag cctggctttt gggggctttg gtggtccccc agctcttggg ctttggccat ggggctcggg gagcagagag ggagtgggag ggaggctggg gaggtgccca ggaggaggag cgggagaggg aggccctgat gctgaagcat ctgcaggaag ccctaggact gcctgctggg aggggggatg agaatcctgc cggaactgtt gagggaaaag aggactggga gatggaggag gaccaggggg aggaagagga ggaggaagca acgccaaccc catcctccgg ccccagcccc tctcccaccc ctgaggacat cgtcacttac atcctgggcc gcctggccgg cctggacgca ggcctgcacc agctgcacgt ccgtctgcac gcgttggaca cccgcgtggt cgagctgacc caggggctgc ggcagctgcg gaacgcggca ggcgacaccc gcgatgccgt gcaagccctg caggaggcgc agggtcgcgc cgagcgcgag cacggccgct tggagggctg cctgaagggg ctgcgcctgg gccacaagtg cttcctgctc tcgcgcgact tcgaagctca ggcggcggcg caggcgcggt gcacggcgcg gggcgggagc ctggcgcagc cggcagaccg ccagcagatg gaggcgctca ctcggtacct gcgcgcggcg ctcgctccct acaactggcc cgtgtggctg ggcgtgcacg atcggcgcgc cgagggcctc tacctcttcg aaaacggcca gcgcgtgtcc ttcttcgcct ggcatcgctc accccgcccc gagctcggcg cccagcccag cgcctcgccg catccgctca gcccggacca gcccaacggt ggcacgctcg agaactgcgt ggcgcaggcc tctgacgacg gctcctggtg ggaccacgac tgccagcggc gtctctacta cgtctgcgag ttccccttct ag. It is sometimes possible for the material contained within the vial of "CLEC11A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.