CAMK1G cdna clone
CAMK1G cDNA Clone
Gene Names
CAMK1G; VWS1; CLICK3; CLICKIII; dJ272L16.1
Synonyms
CAMK1G; CAMK1G cDNA Clone; CAMK1G cdna clone
Sequence
atgggtcgaaaggaagaagatgactgcagttcctggaagaaacagaccaccaacatccggaaaaccttcatttttatggaagtgctgggatcaggagctttctcagaagttttcctggtgaagcaaagactgactgggaagctctttgctctgaagtgcatcaagaagtcacctgccttccgggacagcagcctggagaatgagattgctgtgttgaaaaagatcaagcatgaaaacattgtgaccctggaggacatctatgagagcaccacccactactacctggtcatgcagcttgtttctggtggggagctctttgaccggatcctggagcggggtgtctacacagagaaggatgccagtctggtgatccagcaggtcttgtcggcagtgaaatacctacatgagaatggcatcgtccacagagacttaaagcccgaaaacctgctttaccttacccctgaagagaactctaagatcatgatcactgactttggtctgtccaagatggaacagaatggcatcatgtccactgcctgtgggaccccaggctacgtggctccagaagtgctggcccagaaaccctacagcaaggctgtggattgctggtccatcggcgtcatcacctacatattgctctgtggataccccccgttctatgaagaaacggagtctaagcttttcgagaagatcaaggagggctactatgagtttgagtctccattctgggatgacatttctgagtcagccaaggactttatttgccacttgcttgagaaggatccgaacgagcggtacacctgtgagaaggccttgagtcatccctggattgacggaaacacagccctccaccgggacatctacccatcagtcagcctccagatccagaagaactttgctaagagcaagtggaggcaagccttcaacgcagcagctgtggtgcaccacatgaggaagctacacatgaacctgcacagcccgggcgtccgcccagaggtggagaacaggccgcctgaaactcaagcctcagaaacctctagacccagctcccctgagatcaccatcaccgaggcacctgtcctggaccacagtgtagcactccctgccctgacccaattaccctgccagcatggccgccggcccactgcccctggtggcaggtccctcaactgcctggtcaatggctccctccacatcagcagcagcctggtgcccatgcatcaggggtccctggccgccgggccctgtggctgctgctccagctgcctgaacattgggagcaaaggaaagtcctcctactgctctgagcccacactcctcaaaaaggccaacaaaaaacagaacttcaagtcggaggtcatggtaccagttaaagccagtggcagctcccactgccgggcagggcagactggagtctgtctcattatgtga
Sequence Length
1431
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
51,486 Da
NCBI Official Full Name
Homo sapiens calcium/calmodulin-dependent protein kinase IG, mRNA
NCBI Official Synonym Full Names
calcium/calmodulin dependent protein kinase IG
NCBI Official Symbol
CAMK1G
NCBI Official Synonym Symbols
VWS1; CLICK3; CLICKIII; dJ272L16.1
NCBI Protein Information
calcium/calmodulin-dependent protein kinase type 1G
UniProt Protein Name
Calcium/calmodulin-dependent protein kinase type 1G
Protein Family
UniProt Gene Name
CAMK1G
UniProt Synonym Gene Names
CLICK3; VWS1; CaM kinase IG; CaM-KI gamma; CaMKI gamma; CaMKIG; CLICK III
UniProt Entry Name
KCC1G_HUMAN
NCBI Description
This gene encodes a protein similar to calcium/calmodulin dependent protein kinase, however, its exact function is not known. [provided by RefSeq, Jul 2008]
Uniprot Description
CAMK1G: Calcium/calmodulin-dependent protein kinase belonging to a proposed calcium-triggered signaling cascade. In vitro phosphorylates transcription factor CREB1. Belongs to the protein kinase superfamily. CAMK Ser/Thr protein kinase family. CaMK subfamily. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Protein kinase, Ser/Thr (non-receptor); Protein kinase, CAMK; Kinase, protein; EC 2.7.11.17; CAMK group; CAMK1 family
Chromosomal Location of Human Ortholog: 1q32.2
Research Articles on CAMK1G
Similar Products
Product Notes
The CAMK1G camk1g (Catalog #AAA1270837) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtcgaa aggaagaaga tgactgcagt tcctggaaga aacagaccac caacatccgg aaaaccttca tttttatgga agtgctggga tcaggagctt tctcagaagt tttcctggtg aagcaaagac tgactgggaa gctctttgct ctgaagtgca tcaagaagtc acctgccttc cgggacagca gcctggagaa tgagattgct gtgttgaaaa agatcaagca tgaaaacatt gtgaccctgg aggacatcta tgagagcacc acccactact acctggtcat gcagcttgtt tctggtgggg agctctttga ccggatcctg gagcggggtg tctacacaga gaaggatgcc agtctggtga tccagcaggt cttgtcggca gtgaaatacc tacatgagaa tggcatcgtc cacagagact taaagcccga aaacctgctt taccttaccc ctgaagagaa ctctaagatc atgatcactg actttggtct gtccaagatg gaacagaatg gcatcatgtc cactgcctgt gggaccccag gctacgtggc tccagaagtg ctggcccaga aaccctacag caaggctgtg gattgctggt ccatcggcgt catcacctac atattgctct gtggataccc cccgttctat gaagaaacgg agtctaagct tttcgagaag atcaaggagg gctactatga gtttgagtct ccattctggg atgacatttc tgagtcagcc aaggacttta tttgccactt gcttgagaag gatccgaacg agcggtacac ctgtgagaag gccttgagtc atccctggat tgacggaaac acagccctcc accgggacat ctacccatca gtcagcctcc agatccagaa gaactttgct aagagcaagt ggaggcaagc cttcaacgca gcagctgtgg tgcaccacat gaggaagcta cacatgaacc tgcacagccc gggcgtccgc ccagaggtgg agaacaggcc gcctgaaact caagcctcag aaacctctag acccagctcc cctgagatca ccatcaccga ggcacctgtc ctggaccaca gtgtagcact ccctgccctg acccaattac cctgccagca tggccgccgg cccactgccc ctggtggcag gtccctcaac tgcctggtca atggctccct ccacatcagc agcagcctgg tgcccatgca tcaggggtcc ctggccgccg ggccctgtgg ctgctgctcc agctgcctga acattgggag caaaggaaag tcctcctact gctctgagcc cacactcctc aaaaaggcca acaaaaaaca gaacttcaag tcggaggtca tggtaccagt taaagccagt ggcagctccc actgccgggc agggcagact ggagtctgtc tcattatgtg a. It is sometimes possible for the material contained within the vial of "CAMK1G, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
