Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

BMX cdna clone

BMX cDNA Clone

Gene Names
BMX; ETK; PSCTK2; PSCTK3
Synonyms
BMX; BMX cDNA Clone; BMX cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atggatacaaaatctattctagaagaacttcttctcaaaagatcacagcaaaagaagaaaatgtcaccaaataattacaaagaacggctttttgttttgaccaaaacaaacctttcctactatgaatatgacaaaatgaaaaggggcagcagaaaaggatccattgaaattaagaaaatcagatgtgtggagaaagtaaatctcgaggagcagacgcctgtagagagacagtacccatttcagattgtctataaagatgggcttctctatgtctatgcatcaaatgaagagagccgaagtcagtggttgaaagcattacaaaaagagataaggggtaacccccacctgctggtcaagtaccatagtgggttcttcgtggacgggaagttcctgtgttgccagcagagctgtaaagcagccccaggatgtaccctctgggaagcatatgctaatctgcatactgcagtcaatgaagagaaacacagagttcccaccttcccagacagagtgctgaagatacctcgggcagttcctgttctcaaaatggatgcaccatcttcaagtaccactctagcccaatatgacaacgaatcaaagaaaaactatggctcccagccaccatcttcaagtaccagtctagcgcaatatgacagcaactcaaagaaaatctatggctcccagccaaacttcaacatgcagtatattccaagggaagacttccctgactggtggcaagtaagaaaactgaaaagtagcagcagcagtgaagatgttgcaagcagtaaccaaaaagaaagaaatgtgaatcacaccacctcaaagatttcatgggaattccctgagtcaagttcatctgaagaagaggaaaacctggatgattatgactggtttgctggtaacatctccagatcacaatctgaacagttactcagacaaaagggaaaagaaggagcatttatggttagaaattcgagccaagtgggaatgtacacagtgtccttatttagtaaggctgtgaatgataaaaaaggaactgtcaaacattaccacgtgcatacaaatgctgagaacaaattatacctggcagaaaactactgttttgattccattccaaagcttattcattatcatcaacacaattcagcaggcatgatcacacggctccgccaccctgtgtcaacaaaggccaacaaggtccccgactctgtgtccctgggaaatggaatctgggaactgaaaagagaagagattaccttgttgaaggagctgggaagtggccagtttggagtggtccagctgggcaagtggaaggggcagtatgatgttgctgttaagatgatcaaggagggctccatgtcagaagatgaattctttcaggaggcccagactatgatgaaactcagccatcccaagctggttaaattctatggagtgtgttcaaaggaataccccatatacatagtgactgaatatataagcaatggctgcttgctgaattacctgaggagtcacggaaaaggacttgaaccttcccagctcttagaaatgtgctacgatgtctgtgaaggcatggccttcttggagagtcaccaattcatacaccgggacttggctgctcgtaactgcttggtggacagagatctctgtgtgaaagtatctgactttggaatgacaaggtatgttcttgatgaccagtatgtcagttcagtcggaacaaagtttccagtcaagtggtcagctccagaggtgtttcattacttcaaatacagcagcaagtcagacgtatgggcatttgggatcctgatgtgggaggtgttcagcctggggaagcagccctatgacttgtatgacaactcccaggtggttctgaaggtctcccagggccacaggctttaccggccccacctggcatcggacaccatctaccagatcatgtacagctgctggcacgagcttccagaaaagcgtcccacatttcagcaactcctgtcttccattgaaccacttcgggaaaaagacaagcattga
Sequence Length
2028
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
660
Molecular Weight
78,011 Da
NCBI Official Full Name
Homo sapiens BMX non-receptor tyrosine kinase, mRNA
NCBI Official Synonym Full Names
BMX non-receptor tyrosine kinase
NCBI Official Symbol
BMX
NCBI Official Synonym Symbols
ETK; PSCTK2; PSCTK3
NCBI Protein Information
cytoplasmic tyrosine-protein kinase BMX
UniProt Protein Name
Cytoplasmic tyrosine-protein kinase BMX
UniProt Gene Name
BMX
UniProt Synonym Gene Names
ETK
UniProt Entry Name
BMX_HUMAN

NCBI Description

This gene encodes a non-receptor tyrosine kinase belonging to the Tec kinase family. The protein contains a PH-like domain, which mediates membrane targeting by binding to phosphatidylinositol 3,4,5-triphosphate (PIP3), and a SH2 domain that binds to tyrosine-phosphorylated proteins and functions in signal transduction. The protein is implicated in several signal transduction pathways including the Stat pathway, and regulates differentiation and tumorigenicity of several types of cancer cells. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2016]

Uniprot Description

Etk: a tyrosine kinase of the Tec family. Activity is required for IL6-induced differentiation. May play a role in the growth and differentiation of hematopoietic cells. May be involved in signal transduction in endocardial and arterial endothelial cells.

Protein type: Protein kinase, TK; Protein kinase, tyrosine (non-receptor); Kinase, protein; EC 2.7.10.2; TK group; Tec family

Chromosomal Location of Human Ortholog: Xp22.2

Cellular Component: cytosol; extrinsic to internal side of plasma membrane

Molecular Function: non-membrane spanning protein tyrosine kinase activity; protein binding; protein-tyrosine kinase activity; receptor binding; signal transducer activity

Biological Process: cell structure disassembly during apoptosis; innate immune response; mesoderm development; NK T cell differentiation; protein amino acid autophosphorylation; protein amino acid phosphorylation; regulation of cell proliferation; signal transduction; transmembrane receptor protein tyrosine kinase signaling pathway

Research Articles on BMX

Similar Products

Product Notes

The BMX bmx (Catalog #AAA1275354) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatacaa aatctattct agaagaactt cttctcaaaa gatcacagca aaagaagaaa atgtcaccaa ataattacaa agaacggctt tttgttttga ccaaaacaaa cctttcctac tatgaatatg acaaaatgaa aaggggcagc agaaaaggat ccattgaaat taagaaaatc agatgtgtgg agaaagtaaa tctcgaggag cagacgcctg tagagagaca gtacccattt cagattgtct ataaagatgg gcttctctat gtctatgcat caaatgaaga gagccgaagt cagtggttga aagcattaca aaaagagata aggggtaacc cccacctgct ggtcaagtac catagtgggt tcttcgtgga cgggaagttc ctgtgttgcc agcagagctg taaagcagcc ccaggatgta ccctctggga agcatatgct aatctgcata ctgcagtcaa tgaagagaaa cacagagttc ccaccttccc agacagagtg ctgaagatac ctcgggcagt tcctgttctc aaaatggatg caccatcttc aagtaccact ctagcccaat atgacaacga atcaaagaaa aactatggct cccagccacc atcttcaagt accagtctag cgcaatatga cagcaactca aagaaaatct atggctccca gccaaacttc aacatgcagt atattccaag ggaagacttc cctgactggt ggcaagtaag aaaactgaaa agtagcagca gcagtgaaga tgttgcaagc agtaaccaaa aagaaagaaa tgtgaatcac accacctcaa agatttcatg ggaattccct gagtcaagtt catctgaaga agaggaaaac ctggatgatt atgactggtt tgctggtaac atctccagat cacaatctga acagttactc agacaaaagg gaaaagaagg agcatttatg gttagaaatt cgagccaagt gggaatgtac acagtgtcct tatttagtaa ggctgtgaat gataaaaaag gaactgtcaa acattaccac gtgcatacaa atgctgagaa caaattatac ctggcagaaa actactgttt tgattccatt ccaaagctta ttcattatca tcaacacaat tcagcaggca tgatcacacg gctccgccac cctgtgtcaa caaaggccaa caaggtcccc gactctgtgt ccctgggaaa tggaatctgg gaactgaaaa gagaagagat taccttgttg aaggagctgg gaagtggcca gtttggagtg gtccagctgg gcaagtggaa ggggcagtat gatgttgctg ttaagatgat caaggagggc tccatgtcag aagatgaatt ctttcaggag gcccagacta tgatgaaact cagccatccc aagctggtta aattctatgg agtgtgttca aaggaatacc ccatatacat agtgactgaa tatataagca atggctgctt gctgaattac ctgaggagtc acggaaaagg acttgaacct tcccagctct tagaaatgtg ctacgatgtc tgtgaaggca tggccttctt ggagagtcac caattcatac accgggactt ggctgctcgt aactgcttgg tggacagaga tctctgtgtg aaagtatctg actttggaat gacaaggtat gttcttgatg accagtatgt cagttcagtc ggaacaaagt ttccagtcaa gtggtcagct ccagaggtgt ttcattactt caaatacagc agcaagtcag acgtatgggc atttgggatc ctgatgtggg aggtgttcag cctggggaag cagccctatg acttgtatga caactcccag gtggttctga aggtctccca gggccacagg ctttaccggc cccacctggc atcggacacc atctaccaga tcatgtacag ctgctggcac gagcttccag aaaagcgtcc cacatttcag caactcctgt cttccattga accacttcgg gaaaaagaca agcattga. It is sometimes possible for the material contained within the vial of "BMX, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual