Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BCS1L cdna clone

BCS1L cDNA Clone

Gene Names
BCS1L; BCS; BJS; PTD; BCS1; FLNMS; h-BCS; MC3DN1; h-BCS1; GRACILE; Hs.6719
Synonyms
BCS1L; BCS1L cDNA Clone; BCS1L cdna clone
Ordering
For Research Use Only!
Sequence
atgccactttcagactttattctggctctgaaggacaatccctactttggggctggatttgggctggtgggtgtgggcacagccctggccctggcccggaagggtgtccaactgggcctggtggcattccggcgccattacatgatcacactggaagtccctgctcgagacaggagctatgcctggttgcttagctggctcacccgccacagtacccgtactcagcacctcagtgtcgagacttcgtaccttcagcatgagagtggccgcatttccactaagtttgaatttgtccccagccctggaaaccattttatctggtatcgggggaaatggattcgggtagaacgaagtcgagagatgcagatgatagacttgcagacggggactccttgggaatctgtcaccttcacggccctgggcactgaccgaaaggttttcttcaacatcctggaggaagctcgagagctagccttgcagcaggaggaagggaagaccgtgatgtacacagctgtgggctctgaatggcgtccctttggctatccacgccgccggcgaccactgaattctgtggttctacaacagggtctggctgaccgaattgtcagagacgtccaggaattcatcgataaccccaagtggtacactgacagaggcattccttacagacgtggctacctgctttatgggccccctggttgcggaaagagcagttttatcacagccctggctggggaactggagcacagcatctgcctgctgagcctcacggactccagcctctctgatgaccgactcaaccacctgctgagcgtggccccgcagcagagcctggtactcctggaggatgtggatgctgcttttctcagtcgagacttggctgtggagaacccagtaaagtaccaaggcctaggtcgcctcaccttcagtggactgctcaatgccttggatggtgtggcttccaccgaggcccgcatcgtgttcatgaccaccaaccacgttgacaggctggaccctgccctgatacgcccggggcgagtggacctgaaggagtacgtgggctactgctcacactggcagctgacccagatgttccagaggttctatccagggcaggcaccttccttagctgagaactttgcagaacatgtccttcgagctacaaaccagatcagtcctgcccaggtgcagggctacttcatgctgtataaaaatgaccctgtaggggcaattcacaatgctgagtctctgaggaggtga
Sequence Length
1260
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
617
Molecular Weight
47,534 Da
NCBI Official Full Name
Homo sapiens BCS1-like (yeast), mRNA
NCBI Official Synonym Full Names
BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone
NCBI Official Symbol
BCS1L
NCBI Official Synonym Symbols
BCS; BJS; PTD; BCS1; FLNMS; h-BCS; MC3DN1; h-BCS1; GRACILE; Hs.6719
NCBI Protein Information
mitochondrial chaperone BCS1
UniProt Protein Name
Mitochondrial chaperone BCS1
UniProt Gene Name
BCS1L
UniProt Synonym Gene Names
BCS1; h-BCS1
UniProt Entry Name
BCS1_HUMAN

NCBI Description

This gene encodes a homolog of the S. cerevisiae bcs1 protein which is involved in the assembly of complex III of the mitochondrial respiratory chain. The encoded protein does not contain a mitochondrial targeting sequence but experimental studies confirm that it is imported into mitochondria. Mutations in this gene are associated with mitochondrial complex III deficiency and the GRACILE syndrome. Several alternatively spliced transcripts encoding two different isoforms have been described. [provided by RefSeq, Jan 2016]

Uniprot Description

BCS1L: Chaperone necessary for the assembly of mitochondrial respiratory chain complex III. Plays an important role in the maintenance of mitochondrial tubular networks, respiratory chain assembly and formation of the LETM1 complex. Defects in BCS1L are the cause of GRACILE syndrome (GRACILE). GRACILE stands for 'growth retardation, aminoaciduria, cholestasis, iron overload, lactic acidosis, and early death'. It is a recessively inherited lethal disease characterized by fetal growth retardation, lactic acidosis, aminoaciduria, cholestasis, and abnormalities in iron metabolism. Defects in BCS1L are a cause of mitochondrial complex III deficiency (MT-C3D). A disorder of the mitochondrial respiratory chain resulting in a highly variable phenotype depending on which tissues are affected. Clinical features include mitochondrial encephalopathy, psychomotor retardation, ataxia, severe failure to thrive, liver dysfunction, renal tubulopathy, muscle weakness and exercise intolerance. Defects in BCS1L are the cause of Bjoernstad syndrome (BJS). BJS is an autosomal recessive condition characterized by sensorineural hearing loss and pili torti. The hearing loss in BJS is congenital and of variable severity. Pili torti (twisted hairs), a condition in which the hair shafts are flattened at irregular intervals and twisted 180 degrees from the normal axis, making the hair extremely brittle, is usually recognized early in childhood. Belongs to the AAA ATPase family. BCS1 subfamily.

Protein type: Chaperone; Mitochondrial; Membrane protein, integral

Chromosomal Location of Human Ortholog: 2q33

Cellular Component: mitochondrial respiratory chain complex III; mitochondrion

Molecular Function: protein binding

Biological Process: mitochondrial respiratory chain complex I assembly; mitochondrial respiratory chain complex IV assembly; mitochondrion organization and biogenesis

Disease: Bjornstad Syndrome; Gracile Syndrome; Leigh Syndrome; Mitochondrial Complex Iii Deficiency, Nuclear Type 1

Research Articles on BCS1L

Similar Products

Product Notes

The BCS1L bcs1l (Catalog #AAA1278884) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccacttt cagactttat tctggctctg aaggacaatc cctactttgg ggctggattt gggctggtgg gtgtgggcac agccctggcc ctggcccgga agggtgtcca actgggcctg gtggcattcc ggcgccatta catgatcaca ctggaagtcc ctgctcgaga caggagctat gcctggttgc ttagctggct cacccgccac agtacccgta ctcagcacct cagtgtcgag acttcgtacc ttcagcatga gagtggccgc atttccacta agtttgaatt tgtccccagc cctggaaacc attttatctg gtatcggggg aaatggattc gggtagaacg aagtcgagag atgcagatga tagacttgca gacggggact ccttgggaat ctgtcacctt cacggccctg ggcactgacc gaaaggtttt cttcaacatc ctggaggaag ctcgagagct agccttgcag caggaggaag ggaagaccgt gatgtacaca gctgtgggct ctgaatggcg tccctttggc tatccacgcc gccggcgacc actgaattct gtggttctac aacagggtct ggctgaccga attgtcagag acgtccagga attcatcgat aaccccaagt ggtacactga cagaggcatt ccttacagac gtggctacct gctttatggg ccccctggtt gcggaaagag cagttttatc acagccctgg ctggggaact ggagcacagc atctgcctgc tgagcctcac ggactccagc ctctctgatg accgactcaa ccacctgctg agcgtggccc cgcagcagag cctggtactc ctggaggatg tggatgctgc ttttctcagt cgagacttgg ctgtggagaa cccagtaaag taccaaggcc taggtcgcct caccttcagt ggactgctca atgccttgga tggtgtggct tccaccgagg cccgcatcgt gttcatgacc accaaccacg ttgacaggct ggaccctgcc ctgatacgcc cggggcgagt ggacctgaag gagtacgtgg gctactgctc acactggcag ctgacccaga tgttccagag gttctatcca gggcaggcac cttccttagc tgagaacttt gcagaacatg tccttcgagc tacaaaccag atcagtcctg cccaggtgca gggctacttc atgctgtata aaaatgaccc tgtaggggca attcacaatg ctgagtctct gaggaggtga. It is sometimes possible for the material contained within the vial of "BCS1L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.