ASPRV1 cdna clone
ASPRV1 cDNA Clone
Gene Names
ASPRV1; MUNO; SASP; Taps; SASPase
Synonyms
ASPRV1; ASPRV1 cDNA Clone; ASPRV1 cdna clone
Sequence
atgggtaagggctactatctcaaggggaagattggcaaagtgcccgtgaggttcctggtggactctggggcccaggtctctgtggtccacccaaacttgtgggaggaggtcactgatggcgatctggacaccctgcagccctttgagaatgtggtaaaggtggccaatggtgctgaaatgaagatcctgggtgtctgggatacagcggtgtccctaggcaagctgaagctgaaggcacagttcctagtggccaatgcgagtgccgaggaagccatcattggcactgatgtgctccaggaccacaatgctatcctggactttgagcaccgcacatgcaccctgaaagggaagaagtttcgccttctgcctgtgggagggtccctggaagatgagtttgacctggagctcatagaggaggacccctcctcagaagaagggcggcaggagctatcccactga
Sequence Length
459
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
36,991 Da
NCBI Official Full Name
Homo sapiens aspartic peptidase, retroviral-like 1, mRNA
NCBI Official Synonym Full Names
aspartic peptidase, retroviral-like 1
NCBI Official Symbol
ASPRV1
NCBI Official Synonym Symbols
MUNO; SASP; Taps; SASPase
NCBI Protein Information
retroviral-like aspartic protease 1
UniProt Protein Name
Retroviral-like aspartic protease 1
Protein Family
UniProt Gene Name
ASPRV1
UniProt Synonym Gene Names
SASPase; Skin aspartic protease; TAPS
UniProt Entry Name
APRV1_HUMAN
Uniprot Description
ASPRV1: Homodimer (Potential).
Protein type: Protease; Membrane protein, integral; EC 3.4.23.-
Chromosomal Location of Human Ortholog: 2p13.3
Molecular Function: aspartic-type endopeptidase activity
Biological Process: protein processing; skin development
Research Articles on ASPRV1
Similar Products
Product Notes
The ASPRV1 asprv1 (Catalog #AAA1270841) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtaagg gctactatct caaggggaag attggcaaag tgcccgtgag gttcctggtg gactctgggg cccaggtctc tgtggtccac ccaaacttgt gggaggaggt cactgatggc gatctggaca ccctgcagcc ctttgagaat gtggtaaagg tggccaatgg tgctgaaatg aagatcctgg gtgtctggga tacagcggtg tccctaggca agctgaagct gaaggcacag ttcctagtgg ccaatgcgag tgccgaggaa gccatcattg gcactgatgt gctccaggac cacaatgcta tcctggactt tgagcaccgc acatgcaccc tgaaagggaa gaagtttcgc cttctgcctg tgggagggtc cctggaagat gagtttgacc tggagctcat agaggaggac ccctcctcag aagaagggcg gcaggagcta tcccactga. It is sometimes possible for the material contained within the vial of "ASPRV1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
