ARGLU1 cdna clone
ARGLU1 cDNA Clone
Synonyms
ARGLU1; ARGLU1 cDNA Clone; ARGLU1 cdna clone
Sequence
atgggccggtctcggagccggagctcgtcccgctccaagcacaccaagagcagcaagcacaacaagaagcgcagccggtcccggtcgcgatcccgggacaaggagcgcgtgcggaagcgttccaaatctcgggaaagtaaacggaaccggcggcgggagtcgcggtcccgttcgcgctccaccaacacggccgtgtcccggcgcgagcgggaccgggagcgcgcctcgtccccgcccgaccgcatcgacatcttcgggcgcacggtgagcaagcgcagcagcctggacgagaagcagaagcgagaggaggaggagaagaaagcggagttcgagcggcagcgaaaaattcgacagcaagaaatagaagaaaaactcatcgaggaagaaacagcacgaagagtagaagaattggtagcaaaaagggtggaggaagaactggagaaaaggaaggatgaaattgaacgagaagttctccgaagggtggaggaagccaaacgcatcatggaaaagcagttgctcgaagaactcgagcgacagagacaagctgagcttgccgcacaaaaagctagagaggaggaagaacgtgcaaaacgtgaggagctagagcgaatactggaagagaataaccgaaaaattgcagaagcacaagccaaactggccgaagaacagttgagaattgttgaagaacaaagaaagattcatgaggaaaggatgaaactagaacaagaacgacaacgtcaacaaaaagaagaacaaaaaattatcctgggcaaggggaagtccaggccaaaactgtccttctcattaaaaacccaggattaa
Sequence Length
822
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
23,834 Da
NCBI Official Full Name
Homo sapiens arginine and glutamate rich 1, mRNA
NCBI Official Synonym Full Names
arginine and glutamate rich 1
NCBI Official Symbol
ARGLU1
NCBI Protein Information
arginine and glutamate-rich protein 1
UniProt Protein Name
Arginine and glutamate-rich protein 1
Protein Family
UniProt Gene Name
ARGLU1
UniProt Entry Name
ARGL1_HUMAN
Uniprot Description
ARGLU1: Required for the estrogen-dependent expression of ESR1 target genes. Can act in cooperation with MED1. Belongs to the UPF0430 family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 13q33.3
Cellular Component: cell-cell adherens junction; mitochondrion; nucleoplasm
Molecular Function: protein binding
Research Articles on ARGLU1
Similar Products
Product Notes
The ARGLU1 arglu1 (Catalog #AAA1277314) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggccggt ctcggagccg gagctcgtcc cgctccaagc acaccaagag cagcaagcac aacaagaagc gcagccggtc ccggtcgcga tcccgggaca aggagcgcgt gcggaagcgt tccaaatctc gggaaagtaa acggaaccgg cggcgggagt cgcggtcccg ttcgcgctcc accaacacgg ccgtgtcccg gcgcgagcgg gaccgggagc gcgcctcgtc cccgcccgac cgcatcgaca tcttcgggcg cacggtgagc aagcgcagca gcctggacga gaagcagaag cgagaggagg aggagaagaa agcggagttc gagcggcagc gaaaaattcg acagcaagaa atagaagaaa aactcatcga ggaagaaaca gcacgaagag tagaagaatt ggtagcaaaa agggtggagg aagaactgga gaaaaggaag gatgaaattg aacgagaagt tctccgaagg gtggaggaag ccaaacgcat catggaaaag cagttgctcg aagaactcga gcgacagaga caagctgagc ttgccgcaca aaaagctaga gaggaggaag aacgtgcaaa acgtgaggag ctagagcgaa tactggaaga gaataaccga aaaattgcag aagcacaagc caaactggcc gaagaacagt tgagaattgt tgaagaacaa agaaagattc atgaggaaag gatgaaacta gaacaagaac gacaacgtca acaaaaagaa gaacaaaaaa ttatcctggg caaggggaag tccaggccaa aactgtcctt ctcattaaaa acccaggatt aa. It is sometimes possible for the material contained within the vial of "ARGLU1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
