ANKRD40 cdna clone
ANKRD40 cDNA Clone
Synonyms
ANKRD40; ANKRD40 cDNA Clone; ANKRD40 cdna clone
Sequence
atgaacgccctcctagagcagaaggagcagcaggagaggctgcgggaggccgcggccttaggggacattcgggaggtgcagaaactggtggagagcggggtggatgtgaactcccaaaatgaggtcaacggctggacttgtttacactgggcatgtaaacgaaaccatggtcaggtggtctcttacctgttaaaatcaggagctgacaaagaaattcttaccacaaaaggagaaatgccagtccagttaacatcaaggagagaaatcaggaagattatgggagtggaagaagaagatgatgatgatgatgatgatgacaacctcccccagctgaagaaggagtcagaactgccctttgttcccaactatttggccaacccagccttcccttttatctatacacccacagcagaggattcagcccagatgcagaatgggggcccctccacaccccctgcatcaccccctgcagatggctcacctccattgcttccccctggggaacctcccctgttagggacctttccccgggaccacacctctttggcactagttcagaatggtgatgtgtcggccccctctgccatactcagaacaccagaaagcacaaaaccgggtcctgtttgtcagccaccagtgagtcagagccgctccctgttttcttctgtcccgtccaagccaccaatgtctctggagcctcaaaatgggacgtatgcaggaccagcgccagcattccagccatttttcttcactggagcatttccatttaatatgcaagagctggtactcaaggtgagaattcagaacccatctcttcgagaaaatgatttcattgaaattgaactggaccgacaggagctcacctaccaagagttgctcagagtgtgttgctgtgagctgggtgttaatccagatcaagtggagaagatcagaaagttacccaatactctgttaaggaaggacaaggatgttgctcgactccaagatttccaggagctggaactggttctgatgataagtgaaaataattttctgttcagaaatgctgcatccacactgactgaaaggccttgctataacaggagagcttcaaaactgacttactaa
Sequence Length
1107
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
41,088 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat domain 40, mRNA
NCBI Official Synonym Full Names
ankyrin repeat domain 40
NCBI Official Symbol
ANKRD40
NCBI Protein Information
ankyrin repeat domain-containing protein 40
UniProt Protein Name
Ankyrin repeat domain-containing protein 40
Protein Family
UniProt Gene Name
ANKRD40
UniProt Entry Name
ANR40_HUMAN
Uniprot Description
ANKRD40:
Chromosomal Location of Human Ortholog: 17q21.33
Molecular Function: protein binding
Research Articles on ANKRD40
Similar Products
Product Notes
The ANKRD40 ankrd40 (Catalog #AAA1271330) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacgccc tcctagagca gaaggagcag caggagaggc tgcgggaggc cgcggcctta ggggacattc gggaggtgca gaaactggtg gagagcgggg tggatgtgaa ctcccaaaat gaggtcaacg gctggacttg tttacactgg gcatgtaaac gaaaccatgg tcaggtggtc tcttacctgt taaaatcagg agctgacaaa gaaattctta ccacaaaagg agaaatgcca gtccagttaa catcaaggag agaaatcagg aagattatgg gagtggaaga agaagatgat gatgatgatg atgatgacaa cctcccccag ctgaagaagg agtcagaact gccctttgtt cccaactatt tggccaaccc agccttccct tttatctata cacccacagc agaggattca gcccagatgc agaatggggg cccctccaca ccccctgcat caccccctgc agatggctca cctccattgc ttccccctgg ggaacctccc ctgttaggga cctttccccg ggaccacacc tctttggcac tagttcagaa tggtgatgtg tcggccccct ctgccatact cagaacacca gaaagcacaa aaccgggtcc tgtttgtcag ccaccagtga gtcagagccg ctccctgttt tcttctgtcc cgtccaagcc accaatgtct ctggagcctc aaaatgggac gtatgcagga ccagcgccag cattccagcc atttttcttc actggagcat ttccatttaa tatgcaagag ctggtactca aggtgagaat tcagaaccca tctcttcgag aaaatgattt cattgaaatt gaactggacc gacaggagct cacctaccaa gagttgctca gagtgtgttg ctgtgagctg ggtgttaatc cagatcaagt ggagaagatc agaaagttac ccaatactct gttaaggaag gacaaggatg ttgctcgact ccaagatttc caggagctgg aactggttct gatgataagt gaaaataatt ttctgttcag aaatgctgca tccacactga ctgaaaggcc ttgctataac aggagagctt caaaactgac ttactaa. It is sometimes possible for the material contained within the vial of "ANKRD40, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
