Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ALKBH1 cdna clone

ALKBH1 cDNA Clone

Gene Names
ALKBH1; ABH; ABH1; alkB; hABH; ALKBH
Synonyms
ALKBH1; ALKBH1 cDNA Clone; ALKBH1 cdna clone
Ordering
For Research Use Only!
Sequence
atggggaagatggcagcggccgtgggctctgtggcgactctggcgactgagcccggggaggacgcctttcggaaacttttccgcttctaccgtcagagccggcccgggaccgcagacctggaaggggtcatcgacttctcggcggcccacgcagcccgtggcaagggtcctggtgcccaaaaggtgatcaaatctcagctaaatgtgtcttctgtcagtgagcagaatgcatatagagcaggtcttcagcccgtcagcaagtggcaagcctatggactcaaaggctatcctgggtttatttttatcccaaaccccttcctcccaggttaccagtggcactgggtgaaacagtgccttaagttatattcccagaaacctaatgtatgtaacctggacaaacacatgtctaaagaagagacccaagatctgtgggaacagagcaaagagttcctgaggtataaagaagcgactaaacggagaccccgaagtttactggagaaactgcgttgggtgaccgtaggctaccattataactgggacagtaagaaatactcagcagatcattacacacctttcccttctgacctgggtttcctctcagagcaagtagccgctgcctgtggatttgaggatttccgagctgaagcagggatcctgaattactaccgcctggactccacactgggaatccacgtagacagatctgagctagatcactccaaacccttgctgtcattcagctttggacagtccgccatctttctcctgggtggtcttcaaagggatgaggcccccacggccatgtttatgcacagtggtgacatcatgataatgtcgggtttcagccgcctcttgaaccacgcagtccctcgtgtccttccaaatccagaaggggaaggcctgcctcactgcctagaggcacctctccctgctgtcctcccgagagattcaatggtagagccttgttctatggaggactggcaggtgtgtgccagctacttgaagaccgctcgtgttaacatgactgtccgacaggtcctggccacagaccagaatttccctctagaacccatcgaggatgaaaaaagagacatcagtacagaaggtttctgccatctggatgaccagaatagcgaagtaaaacgggccaggataaaccctcacagctga
Sequence Length
1170
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,832 Da
NCBI Official Full Name
Homo sapiens alkB, alkylation repair homolog 1 (E. coli), mRNA
NCBI Official Synonym Full Names
alkB homolog 1, histone H2A dioxygenase
NCBI Official Symbol
ALKBH1
NCBI Official Synonym Symbols
ABH; ABH1; alkB; hABH; ALKBH
NCBI Protein Information
DNA demethylase ALKBH1
UniProt Protein Name
DNA demethylase ALKBH1
Protein Family
UniProt Gene Name
ALKBH1
UniProt Entry Name
ALKB1_HUMAN

NCBI Description

This gene encodes a homolog to the E. coli alkB gene product. The E. coli alkB protein is part of the adaptive response mechanism of DNA alkylation damage repair. It is involved in damage reversal by oxidative demethylation of 1-methyladenine and 3-methylcytosine. [provided by RefSeq, Jul 2008]

Uniprot Description

ALKBH: Dioxygenase that repairs alkylated single-stranded DNA and RNA containing 3-methylcytosine by oxidative demethylation. Requires molecular oxygen, alpha-ketoglutarate and iron. May have a role in placental trophoblast lineage differentiation. Has DNA lyase activity and introduces double-stranded breaks at abasic sites. Cleaves both single-stranded DNA and double-stranded DNA at abasic sites, with the greatest activity towards double-stranded DNA with two abasic sites. DNA lyase activity does not require alpha-ketoglutarate and iron. Belongs to the alkB family.

Protein type: EC 4.2.99.18; DNA repair, damage; EC 1.14.11.33

Chromosomal Location of Human Ortholog: 14q24.3

Cellular Component: mitochondrion

Molecular Function: DNA-(apurinic or apyrimidinic site) lyase activity; ferrous iron binding

Biological Process: DNA dealkylation; DNA repair; RNA repair

Research Articles on ALKBH1

Similar Products

Product Notes

The ALKBH1 alkbh1 (Catalog #AAA1266986) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggaaga tggcagcggc cgtgggctct gtggcgactc tggcgactga gcccggggag gacgcctttc ggaaactttt ccgcttctac cgtcagagcc ggcccgggac cgcagacctg gaaggggtca tcgacttctc ggcggcccac gcagcccgtg gcaagggtcc tggtgcccaa aaggtgatca aatctcagct aaatgtgtct tctgtcagtg agcagaatgc atatagagca ggtcttcagc ccgtcagcaa gtggcaagcc tatggactca aaggctatcc tgggtttatt tttatcccaa accccttcct cccaggttac cagtggcact gggtgaaaca gtgccttaag ttatattccc agaaacctaa tgtatgtaac ctggacaaac acatgtctaa agaagagacc caagatctgt gggaacagag caaagagttc ctgaggtata aagaagcgac taaacggaga ccccgaagtt tactggagaa actgcgttgg gtgaccgtag gctaccatta taactgggac agtaagaaat actcagcaga tcattacaca cctttccctt ctgacctggg tttcctctca gagcaagtag ccgctgcctg tggatttgag gatttccgag ctgaagcagg gatcctgaat tactaccgcc tggactccac actgggaatc cacgtagaca gatctgagct agatcactcc aaacccttgc tgtcattcag ctttggacag tccgccatct ttctcctggg tggtcttcaa agggatgagg cccccacggc catgtttatg cacagtggtg acatcatgat aatgtcgggt ttcagccgcc tcttgaacca cgcagtccct cgtgtccttc caaatccaga aggggaaggc ctgcctcact gcctagaggc acctctccct gctgtcctcc cgagagattc aatggtagag ccttgttcta tggaggactg gcaggtgtgt gccagctact tgaagaccgc tcgtgttaac atgactgtcc gacaggtcct ggccacagac cagaatttcc ctctagaacc catcgaggat gaaaaaagag acatcagtac agaaggtttc tgccatctgg atgaccagaa tagcgaagta aaacgggcca ggataaaccc tcacagctga. It is sometimes possible for the material contained within the vial of "ALKBH1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.