Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AKT1 cdna clone

AKT1 cDNA Clone

Gene Names
AKT1; AKT; PKB; RAC; CWS6; PRKBA; PKB-ALPHA; RAC-ALPHA
Synonyms
AKT1; AKT1 cDNA Clone; AKT1 cdna clone
Ordering
For Research Use Only!
Sequence
atgagcgacgtggctattgtgaaggagggttggctgcacaaacgaggggagtacatcaagacctggcggccacgctacttcctcctcaagaatgatggcaccttcattggctacaaggagcggccgcaggatgtggaccaacgtgaggctcccctcaacaacttctctgtggcgcagtgccagctgatgaagacggagcggccccggcccaacaccttcatcatccgctgcctgcagtggaccactgtcatcgaacgcaccttccatgtggagactcctgaggagcgggaggagtggacaaccgccatccagactgtggctgacggcctcaagaagcaggaggaggaggagatggacttccggtcgggctcacccagtgacaactcaggggctgaagagatggaggtgtccctggccaagcccaagcaccgcgtgaccatgaacgagtttgagtacctgaagctgctgggcaagggcactttcggcaaggtgatcctggtgaaggagaaggccacaggccgctactacgccatgaagatcctcaagaaggaagtcatcgtggccaaggacgaggtggcccacacactcaccgagaaccgcgtcctgcagaactccaggcaccccttcctcacagccctgaagtactctttccagacccacgaccgcctctgctttgtcatggagtacgccaacgggggcgagctgttcttccacctgtcccgggagcgtgtgttctccgaggaccgggcccgcttctatggcgctgagattgtgtcagccctggactacctgcactcggagaagaacgtggtgtaccgggacctcaagctggagaacctcatgctggacaaggacgggcacattaagatcacagacttcgggctgtgcaaggaggggatcaaggacggtgccaccatgaagaccttttgcggcacacctgagtacctggcccccgaggtgctggaggacaatgactacggccgtgcagtggactggtgggggctgggcgtggtcatgtacgagatgatgtgcggtcgcctgcccttctacaaccaggaccatgagaagctttttgagctcatcctcatggaggagatccgcttcccgcgcacgcttggtcccgaggccaagtccttgctttcagggctgctcaagaaggaccccaagcagaggcttggcgggggctccgaggacgccaaggagatcatgcagcatcgcttctttgccggtatcgtgtggcagcacgtgtacgagaagaagctcagcccacccttcaagccccaggtcacgtcggagactgacaccaggtattttgatgaggagttcacggcccagatgatcaccatcacaccacctgaccaagatgacagcatggagtgtgtggacagcgagcgcaggccccacttcccccagttctcctactcggccagcggcacggcctga
Sequence Length
1443
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
207
Molecular Weight
48,347 Da
NCBI Official Full Name
Homo sapiens v-akt murine thymoma viral oncogene homolog 1, mRNA
NCBI Official Synonym Full Names
AKT serine/threonine kinase 1
NCBI Official Symbol
AKT1
NCBI Official Synonym Symbols
AKT; PKB; RAC; CWS6; PRKBA; PKB-ALPHA; RAC-ALPHA
NCBI Protein Information
RAC-alpha serine/threonine-protein kinase
UniProt Protein Name
RAC-alpha serine/threonine-protein kinase
Protein Family
UniProt Gene Name
AKT1
UniProt Synonym Gene Names
PKB; RAC; PKB; PKB alpha
UniProt Entry Name
AKT1_HUMAN

NCBI Description

The serine-threonine protein kinase encoded by the AKT1 gene is catalytically inactive in serum-starved primary and immortalized fibroblasts. AKT1 and the related AKT2 are activated by platelet-derived growth factor. The activation is rapid and specific, and it is abrogated by mutations in the pleckstrin homology domain of AKT1. It was shown that the activation occurs through phosphatidylinositol 3-kinase. In the developing nervous system AKT is a critical mediator of growth factor-induced neuronal survival. Survival factors can suppress apoptosis in a transcription-independent manner by activating the serine/threonine kinase AKT1, which then phosphorylates and inactivates components of the apoptotic machinery. Mutations in this gene have been associated with the Proteus syndrome. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2011]

Uniprot Description

Akt1: an oncogenic AGC kinase that plays a critical role in regulating cell survival and metabolism in many different signaling pathways. Dual phosphorylation is required for its activation. T308 is phosphorylated by PDK1 in the PI3 kinase pathway, and S473 is phosphorylated by mTOR in the mTORC2 pathway. The 'Lys-63'-linked ubiquitination of AKT1 by TRAF6 is important for its translocation to the plasma membrane, phosphorylation, and activation. When Akt is fully phosphorylated it translocates into the nucleus, undergoes 'Lys-48'-polyubiquitination catalyzed by TTC3, leading to its proteosomal degradation. Hyperactive or overexpressed in a number of cancers including breast, prostate, lung, pancreatic, liver, ovarian and colorectal. Over 160 protein substrates are known including many that regulate transcription, metabolism, apoptosis, cell cycle, and growth.

Protein type: EC 2.7.11.1; Protein kinase, Ser/Thr (non-receptor); Kinase, protein; Oncoprotein; Protein kinase, AGC; AGC group; AKT family

Chromosomal Location of Human Ortholog: 14q32.32

Cellular Component: cytoplasm; cytosol; microtubule cytoskeleton; nucleoplasm; nucleus; plasma membrane; vesicle

Molecular Function: ATP binding; enzyme binding; identical protein binding; kinase activity; nitric-oxide synthase regulator activity; phosphatidylinositol-3,4,5-triphosphate binding; phosphatidylinositol-3,4-bisphosphate binding; protein binding; protein kinase activity; protein serine/threonine kinase activity; protein serine/threonine/tyrosine kinase activity

Biological Process: activated T cell apoptosis; cell differentiation; cell proliferation; cellular response to insulin stimulus; endocrine pancreas development; G-protein coupled receptor protein signaling pathway; G1/S-specific positive regulation of cyclin-dependent protein kinase activity; insulin receptor signaling pathway; insulin-like growth factor receptor signaling pathway; negative regulation of apoptosis; negative regulation of autophagy; negative regulation of caspase activity; negative regulation of fatty acid beta-oxidation; negative regulation of protein kinase activity; negative regulation of proteolysis; nitric oxide biosynthetic process; peptidyl-serine phosphorylation; peptidyl-threonine phosphorylation; phosphoinositide-mediated signaling; phosphorylation; platelet activation; positive regulation of blood vessel endothelial cell migration; positive regulation of cell growth; positive regulation of cellular protein metabolic process; positive regulation of endodeoxyribonuclease activity; positive regulation of endothelial cell proliferation; positive regulation of epidermal growth factor receptor signaling pathway; positive regulation of fat cell differentiation; positive regulation of glucose import; positive regulation of glycogen biosynthetic process; positive regulation of lipid biosynthetic process; positive regulation of nitric oxide biosynthetic process; positive regulation of nitric-oxide synthase activity; positive regulation of peptidyl-serine phosphorylation; positive regulation of protein amino acid phosphorylation; positive regulation of transcription factor activity; protein amino acid autophosphorylation; protein amino acid phosphorylation; protein import into nucleus, translocation; protein modification process; regulation of cell migration; regulation of glycogen biosynthetic process; regulation of mRNA stability; regulation of nitric-oxide synthase activity; regulation of phosphoinositide 3-kinase cascade; response to heat; response to oxidative stress; signal transduction; T cell costimulation

Disease: Breast Cancer; Colorectal Cancer; Cowden Syndrome 6; Ovarian Cancer; Proteus Syndrome; Schizophrenia

Research Articles on AKT1

Similar Products

Product Notes

The AKT1 akt1 (Catalog #AAA1267543) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcgacg tggctattgt gaaggagggt tggctgcaca aacgagggga gtacatcaag acctggcggc cacgctactt cctcctcaag aatgatggca ccttcattgg ctacaaggag cggccgcagg atgtggacca acgtgaggct cccctcaaca acttctctgt ggcgcagtgc cagctgatga agacggagcg gccccggccc aacaccttca tcatccgctg cctgcagtgg accactgtca tcgaacgcac cttccatgtg gagactcctg aggagcggga ggagtggaca accgccatcc agactgtggc tgacggcctc aagaagcagg aggaggagga gatggacttc cggtcgggct cacccagtga caactcaggg gctgaagaga tggaggtgtc cctggccaag cccaagcacc gcgtgaccat gaacgagttt gagtacctga agctgctggg caagggcact ttcggcaagg tgatcctggt gaaggagaag gccacaggcc gctactacgc catgaagatc ctcaagaagg aagtcatcgt ggccaaggac gaggtggccc acacactcac cgagaaccgc gtcctgcaga actccaggca ccccttcctc acagccctga agtactcttt ccagacccac gaccgcctct gctttgtcat ggagtacgcc aacgggggcg agctgttctt ccacctgtcc cgggagcgtg tgttctccga ggaccgggcc cgcttctatg gcgctgagat tgtgtcagcc ctggactacc tgcactcgga gaagaacgtg gtgtaccggg acctcaagct ggagaacctc atgctggaca aggacgggca cattaagatc acagacttcg ggctgtgcaa ggaggggatc aaggacggtg ccaccatgaa gaccttttgc ggcacacctg agtacctggc ccccgaggtg ctggaggaca atgactacgg ccgtgcagtg gactggtggg ggctgggcgt ggtcatgtac gagatgatgt gcggtcgcct gcccttctac aaccaggacc atgagaagct ttttgagctc atcctcatgg aggagatccg cttcccgcgc acgcttggtc ccgaggccaa gtccttgctt tcagggctgc tcaagaagga ccccaagcag aggcttggcg ggggctccga ggacgccaag gagatcatgc agcatcgctt ctttgccggt atcgtgtggc agcacgtgta cgagaagaag ctcagcccac ccttcaagcc ccaggtcacg tcggagactg acaccaggta ttttgatgag gagttcacgg cccagatgat caccatcaca ccacctgacc aagatgacag catggagtgt gtggacagcg agcgcaggcc ccacttcccc cagttctcct actcggccag cggcacggcc tga. It is sometimes possible for the material contained within the vial of "AKT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.