AEBP2 cdna clone
AEBP2 cDNA Clone
Synonyms
AEBP2; AEBP2 cDNA Clone; AEBP2 cdna clone
Sequence
atgtcgtcggatggggaacccctgagccgcatggactcggaggacagcataagcagtactataatggatgtagacagcacaatttccagtgggcgttcaactccagcaatgatgaatggacaaggaagcactacttcttcaagcaaaaatattgcctataattgttgttgggaccagtgccaggcttgcttcaactctagcccagatctggcagatcacatccgttccatacatgtagatggtcagcgaggaggggtatttgtttgcttatggaaaggttgtaaagtatataacactccatctaccagtcaaagttggttacaaaggcatatgctgacacacagtggagacaaacctttcaagtgtgttgttggtggctgcaatgccagctttgcttctcagggagggctagctcgtcatgtacccacacacttcagtcagcagaactcctcaaaagtttctagccagccaaaggccaaagaagaatctccttctaaagctggaatgaacaaaaggaggaaattaaagaacaaaagacgacgctcattaccacggccacatgatttcttcgatgcacaaacactggatgcgataagacatcgagccatatgctttaacctctcagctcatatagaaagtttagggaagggacacagtgttgtttttcatagtactgtaatagctaagagaaaagaagattctgggaagatcaaacttttgcttcattggatgcctgaagacattctgcctgatgtgtgggtgaatgaaagtgaacgacatcagttaaaaactaaagtagttcatttatcaaagctacccaaagatactgccttgcttttggacccaaacatatacagaacaatgccgcagaagaggttgaagaggtaa
Sequence Length
888
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
33,981 Da
NCBI Official Full Name
Homo sapiens AE binding protein 2, mRNA
NCBI Official Synonym Full Names
AE binding protein 2
NCBI Official Symbol
AEBP2
NCBI Protein Information
zinc finger protein AEBP2
UniProt Protein Name
Zinc finger protein AEBP2
Protein Family
UniProt Gene Name
AEBP2
UniProt Synonym Gene Names
AE-binding protein 2
UniProt Entry Name
AEBP2_HUMAN
Uniprot Description
AEBP2: DNA-binding transcriptional repressor. May interact with and stimulate the activity of the PRC2 complex, which methylates 'Lys-9' and 'Lys-27' residues of histone H3. Belongs to the AEBP2/jing C2H2-type zinc-finger family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Transcription, coactivator/corepressor; Motility/polarity/chemotaxis; C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 12p12.3
Cellular Component: ESC/E(Z) complex; nucleoplasm; nucleus
Biological Process: negative regulation of gene expression, epigenetic
Research Articles on AEBP2
Similar Products
Product Notes
The AEBP2 aebp2 (Catalog #AAA1269293) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgtcgg atggggaacc cctgagccgc atggactcgg aggacagcat aagcagtact ataatggatg tagacagcac aatttccagt gggcgttcaa ctccagcaat gatgaatgga caaggaagca ctacttcttc aagcaaaaat attgcctata attgttgttg ggaccagtgc caggcttgct tcaactctag cccagatctg gcagatcaca tccgttccat acatgtagat ggtcagcgag gaggggtatt tgtttgctta tggaaaggtt gtaaagtata taacactcca tctaccagtc aaagttggtt acaaaggcat atgctgacac acagtggaga caaacctttc aagtgtgttg ttggtggctg caatgccagc tttgcttctc agggagggct agctcgtcat gtacccacac acttcagtca gcagaactcc tcaaaagttt ctagccagcc aaaggccaaa gaagaatctc cttctaaagc tggaatgaac aaaaggagga aattaaagaa caaaagacga cgctcattac cacggccaca tgatttcttc gatgcacaaa cactggatgc gataagacat cgagccatat gctttaacct ctcagctcat atagaaagtt tagggaaggg acacagtgtt gtttttcata gtactgtaat agctaagaga aaagaagatt ctgggaagat caaacttttg cttcattgga tgcctgaaga cattctgcct gatgtgtggg tgaatgaaag tgaacgacat cagttaaaaa ctaaagtagt tcatttatca aagctaccca aagatactgc cttgcttttg gacccaaaca tatacagaac aatgccgcag aagaggttga agaggtaa. It is sometimes possible for the material contained within the vial of "AEBP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
