Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ACAT1 cdna clone

ACAT1 cDNA Clone

Gene Names
ACAT1; T2; MAT; ACAT; THIL
Synonyms
ACAT1; ACAT1 cDNA Clone; ACAT1 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgtgctgccggcacttctgcgcagcggcgcccgcagccgcagccccctgctccggaggctggtgcaggaaataagatatgtggaacggagttatgtatcaaaacccactttgaaggaagtggtcatagtaagtgctacaagaacacccattggatcttttttaggcagcctttccttgctgccagccactaagcttggttccattgcaattcagggagccattgaaaaggcagggattccaaaagaagaagtgaaagaagcatacatgggtaatgttctacaaggaggtgaaggacaagctcctacaaggcaggcagtattgggtgcaggcttacctatttctactccatgtaccaccataaacaaagtttgtgcttcaggaatgaaagccatcatgatggcctctcaaagtcttatgtgtggacatcagatcaagcaagagacaggctccttagcaaaaatatgctgtcatgtcaggaggtga
Sequence Length
489
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
38
Molecular Weight
17,175 Da
NCBI Official Full Name
Homo sapiens acetyl-Coenzyme A acetyltransferase 1, mRNA
NCBI Official Synonym Full Names
acetyl-CoA acetyltransferase 1
NCBI Official Symbol
ACAT1
NCBI Official Synonym Symbols
T2; MAT; ACAT; THIL
NCBI Protein Information
acetyl-CoA acetyltransferase, mitochondrial
UniProt Protein Name
Acetyl-CoA acetyltransferase, mitochondrial
UniProt Gene Name
ACAT1
UniProt Synonym Gene Names
ACAT; MAT
UniProt Entry Name
THIL_HUMAN

NCBI Description

This gene encodes a mitochondrially localized enzyme that catalyzes the reversible formation of acetoacetyl-CoA from two molecules of acetyl-CoA. Defects in this gene are associated with 3-ketothiolase deficiency, an inborn error of isoleucine catabolism characterized by urinary excretion of 2-methyl-3-hydroxybutyric acid, 2-methylacetoacetic acid, tiglylglycine, and butanone. [provided by RefSeq, Feb 2009]

Uniprot Description

ACAT1: Plays a major role in ketone body metabolism. Defects in ACAT1 are a cause of 3-ketothiolase deficiency (3KTD); also known as alpha- methylacetoaceticaciduria. 3KTD is an inborn error of isoleucine catabolism characterized by intermittent ketoacidotic attacks associated with unconsciousness. Some patients die during an attack or are mentally retarded. Urinary excretion of 2-methyl-3- hydroxybutyric acid, 2-methylacetoacetic acid, triglylglycine, butanone is increased. It seems likely that the severity of this disease correlates better with the environmental or acquired factors than with the ACAT1 genotype. Belongs to the thiolase family.

Protein type: Secondary Metabolites Metabolism - terpenoid backbone biosynthesis; Carbohydrate Metabolism - pyruvate; Amino Acid Metabolism - lysine degradation; Lipid Metabolism - synthesis and degradation of ketone bodies; Amino Acid Metabolism - valine, leucine and isoleucine degradation; Lipid Metabolism - fatty acid; Carbohydrate Metabolism - propanoate; Amino Acid Metabolism - tryptophan; EC 2.3.1.9; Carbohydrate Metabolism - butanoate; Acetyltransferase; Mitochondrial

Chromosomal Location of Human Ortholog: 11q22.3

Cellular Component: mitochondrial matrix; mitochondrion

Molecular Function: acetyl-CoA C-acetyltransferase activity

Biological Process: branched chain family amino acid catabolic process; ketone body biosynthetic process; ketone body catabolic process

Disease: Alpha-methylacetoacetic Aciduria

Research Articles on ACAT1

Similar Products

Product Notes

The ACAT1 acat1 (Catalog #AAA1274205) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgtgc tgccggcact tctgcgcagc ggcgcccgca gccgcagccc cctgctccgg aggctggtgc aggaaataag atatgtggaa cggagttatg tatcaaaacc cactttgaag gaagtggtca tagtaagtgc tacaagaaca cccattggat cttttttagg cagcctttcc ttgctgccag ccactaagct tggttccatt gcaattcagg gagccattga aaaggcaggg attccaaaag aagaagtgaa agaagcatac atgggtaatg ttctacaagg aggtgaagga caagctccta caaggcaggc agtattgggt gcaggcttac ctatttctac tccatgtacc accataaaca aagtttgtgc ttcaggaatg aaagccatca tgatggcctc tcaaagtctt atgtgtggac atcagatcaa gcaagagaca ggctccttag caaaaatatg ctgtcatgtc aggaggtga. It is sometimes possible for the material contained within the vial of "ACAT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.