ABTB1 cdna clone
ABTB1 cDNA Clone
Gene Names
ABTB1; BPOZ; BTB3; BTBD21; EF1ABP; PP2259
Synonyms
ABTB1; ABTB1 cDNA Clone; ABTB1 cdna clone
Sequence
atggacaccagcgacctgttcgccagctgcaggaagggggatgtgggccgagtgcggtacctgctggagcagcgagacgtggaggtgaatgtgcgggacaagtgggacagcacccccttgtactatgcctgcttgtgtgggcacgaggagctggtactctaccttctggccaatggagcccgctgcgaggccaacaccttcgatggtgagcgctgcctctatggggcactgagtgaccccatccgccgggctctacgcgattacaagcaggtcacggcttcctgcaggaggcgggattactatgacgacttcttgcagcggcttctagagcagggcatccacagtgacgtggtctttgtagtacacgggaagccattccgggtgcatcgctgcgtcctgggtgcacgtagtgcctactttgccaacatgctggacaccaaatggaagggcaagagtgtcgtggttctcaggcacccactgatcaaccccgtggcctttggggccctgctgcagtacctgtacacaggccgcctggacattggcgtagagcatgtgagtgactgtgagcgcctggccaagcaatgccagctgtgggacctgctcagcgacctggaggccaagtgcgagaaggtgtctgagtttgtggcgtctaagccaggcacgtgtgtgaaggtgctgaccatcgagcccccacctgcagacccccgcctccgggaggacatggcgctgctggccgattgtgccctgccccccgagctccgaggtgatctttgggagctgcccttcccttgtcctgacggcttcaacagctgccctgacatctgcttccgagtggctggctgcagcttcctctgccacaaggcctttttctgtggccgcagtgactacttccgagccctgctggatgaccacttccgagagagcgaggagccagcgacctcagggggccccccagccgtcaccctgcatggcatctcacccgacgtcttcactcacgtgctctactacatgtacagcgaccacactgagctgtcccccgaggcagcctatgatgtgctgagcgtcgccgacatgtacctgctgccaggcctgaagaggctgtgcggccgcagcctggctcagatgctagacgaggacactgtggtgggtgtgtggcgcgtggccaagctcttccgcctggcgcggcttgaggaccagtgcactgagtacatggccaaggtcattgagaagctggtggagcgggaggacttcgtggaggcggtgaaggaggaggcagcggctgtggcagcccggcaggagacggactctatcccgctggtggacgacatccgcttccacgtggccagcacggtgcagacctacagcgccatagaggaggcgcagcagcgtctgcgggcactcgaggacctgctcgtgtccatcggtctggactgttga
Sequence Length
1437
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
44,428 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat and BTB (POZ) domain containing 1, mRNA
NCBI Official Synonym Full Names
ankyrin repeat and BTB domain containing 1
NCBI Official Symbol
ABTB1
NCBI Official Synonym Symbols
BPOZ; BTB3; BTBD21; EF1ABP; PP2259
NCBI Protein Information
ankyrin repeat and BTB/POZ domain-containing protein 1
UniProt Protein Name
Ankyrin repeat and BTB/POZ domain-containing protein 1
Protein Family
UniProt Gene Name
ABTB1
UniProt Entry Name
ABTB1_HUMAN
NCBI Description
This gene encodes a protein with an ankyrin repeat region and two BTB/POZ domains, which are thought to be involved in protein-protein interactions. Expression of this gene is activated by the phosphatase and tensin homolog, a tumor suppressor. Alternate splicing results in three transcript variants. [provided by RefSeq, Mar 2010]
Uniprot Description
ABTB1: May act as a mediator of the PTEN growth-suppressive signaling pathway. May play a role in developmental processes. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Translation; RNA-binding
Chromosomal Location of Human Ortholog: 3q21
Cellular Component: cytoplasm; nucleolus; plasma membrane; SCF ubiquitin ligase complex
Molecular Function: protein binding; ubiquitin protein ligase binding
Biological Process: proteasomal ubiquitin-dependent protein catabolic process; protein ubiquitination during ubiquitin-dependent protein catabolic process; regulation of proteolysis
Research Articles on ABTB1
Similar Products
Product Notes
The ABTB1 abtb1 (Catalog #AAA1269365) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacacca gcgacctgtt cgccagctgc aggaaggggg atgtgggccg agtgcggtac ctgctggagc agcgagacgt ggaggtgaat gtgcgggaca agtgggacag cacccccttg tactatgcct gcttgtgtgg gcacgaggag ctggtactct accttctggc caatggagcc cgctgcgagg ccaacacctt cgatggtgag cgctgcctct atggggcact gagtgacccc atccgccggg ctctacgcga ttacaagcag gtcacggctt cctgcaggag gcgggattac tatgacgact tcttgcagcg gcttctagag cagggcatcc acagtgacgt ggtctttgta gtacacggga agccattccg ggtgcatcgc tgcgtcctgg gtgcacgtag tgcctacttt gccaacatgc tggacaccaa atggaagggc aagagtgtcg tggttctcag gcacccactg atcaaccccg tggcctttgg ggccctgctg cagtacctgt acacaggccg cctggacatt ggcgtagagc atgtgagtga ctgtgagcgc ctggccaagc aatgccagct gtgggacctg ctcagcgacc tggaggccaa gtgcgagaag gtgtctgagt ttgtggcgtc taagccaggc acgtgtgtga aggtgctgac catcgagccc ccacctgcag acccccgcct ccgggaggac atggcgctgc tggccgattg tgccctgccc cccgagctcc gaggtgatct ttgggagctg cccttccctt gtcctgacgg cttcaacagc tgccctgaca tctgcttccg agtggctggc tgcagcttcc tctgccacaa ggcctttttc tgtggccgca gtgactactt ccgagccctg ctggatgacc acttccgaga gagcgaggag ccagcgacct cagggggccc cccagccgtc accctgcatg gcatctcacc cgacgtcttc actcacgtgc tctactacat gtacagcgac cacactgagc tgtcccccga ggcagcctat gatgtgctga gcgtcgccga catgtacctg ctgccaggcc tgaagaggct gtgcggccgc agcctggctc agatgctaga cgaggacact gtggtgggtg tgtggcgcgt ggccaagctc ttccgcctgg cgcggcttga ggaccagtgc actgagtaca tggccaaggt cattgagaag ctggtggagc gggaggactt cgtggaggcg gtgaaggagg aggcagcggc tgtggcagcc cggcaggaga cggactctat cccgctggtg gacgacatcc gcttccacgt ggccagcacg gtgcagacct acagcgccat agaggaggcg cagcagcgtc tgcgggcact cgaggacctg ctcgtgtcca tcggtctgga ctgttga. It is sometimes possible for the material contained within the vial of "ABTB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
