H3F3A cdna clone

H3F3A

Cat. Num. AAA200928

• Synonyms: H3F3A; H3.3A; H3F3; H3F3A cdna clone

• Form/Format: Lyophilized
• Sequence: Nucleotide Sequence: ATGGCTCGTACAAAGCAGACTGCCCGCAAATCGACCGGTGGTAAAGCACCCAGGAAGCAACTGGCTACAAAAGCCGCTCGCAAGAGTGCGCCCTCTACTGGAGGGGTGAAGAAACCTCATCGTTACAGGCCTGGTACTGTGGCGCTCCGTGAAATTAGACGTTATCAGAAGTCCACTGAACTTCTGATTCGCAAACTTCCCTTCCAGCGTCTGGTGCGAGAAATTGCTCAGGACTTTAAAACAGATCTGCGCTTCCAGAGCGCAGCTATCGGTGCTTTGCAGGAGGCAAGTGAGGCCTATCTGGTTGGCCTTTTTGAAGACACCAACCTGTGTGCTATCCATGCCAAACGTGTAACAATTATGCCAAAAGACATCCAGCTAGCACGCCGCATACGTGGAGAACGTGCTTAA; ; Translation Sequence: MARTKQTARK STGGKAPRKQ LATKAARKSA PSTGGVKKPH RYRPGTVALR EIRRYQKSTE LLIRKLPFQR LVREIAQDFK TDLRFQSAAI GALQEASEAY LVGLFEDTNL CAIHAKRVTI MPKDIQLARR IRGERA
• Sequence Length: 136

• Species: Human
• Chromosome Location: 1q42.12
• OMIM Reference Number: 601128
• cDNA Size: 411bp
• Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
• Vector: (puc19-derived cloning vector)
• Preparation Before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
• Preparation and Storage: Store the plasmid at -20 degree C.

Related Product Information for H3F3A cdna clone

H3F3A is a variant histone H3 which replaces conventional H3 in a wide range of nucleosomes in active genes. It constitutes the predominant form of histone H3 in non-dividing cells and is incorporated into chromatin independently of DNA synthesis.

Product Categories/Family for H3F3A cdna clone

Epigenomics (Transcription & Translation)

NCBI and Uniprot Product Information

• NCBI GI #: 4504279
• NCBI Accession #: NP_002098.1
• NCBI GenBank Nucleotide #: NM_002107.4
• UniProt Accession #: P84243
• NCBI Official Full Name: histone H3.3
• UniProt Protein Name: Histone H3.3
• UniProt Gene Name: H3F3A
• UniProt Synonym Gene Names: H3.3A; H3F3
• UniProt Entry Name: H33_HUMAN

Uniprot Description

H3F3A: Variant histone H3 which replaces conventional H3 in a wide range of nucleosomes in active genes. Constitutes the predominant form of histone H3 in non-dividing cells and is incorporated into chromatin independently of DNA synthesis. Deposited at sites of nucleosomal displacement throughout transcribed genes, suggesting that it represents an epigenetic imprint of transcriptionally active chromatin. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling. The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA. Interacts with HIRA, a chaperone required for its incorporation into nucleosomes. Belongs to the histone H3 family.

Protein type: DNA-binding

Chromosomal Location of Human Ortholog: 1q42.12

Cellular Component: nucleoplasm; nuclear chromosome; protein complex; extracellular region; nucleosome; nucleus

Molecular Function: protein binding; nucleosomal DNA binding; protein heterodimerization activity

Biological Process: chromatin silencing at rDNA; nucleosome assembly; DNA replication-independent nucleosome assembly; negative regulation of gene expression, epigenetic; gene expression; blood coagulation; DNA methylation on cytosine; positive regulation of cell growth; regulation of gene expression, epigenetic