TMPRSS11B cdna clone

TMPRSS11B cDNA Clone

Synonyms

TMPRSS11B; TMPRSS11B cDNA Clone; TMPRSS11B cdna clone

Ordering
Cat. Num. AAA1278964 For Research Use Only!

Sequence

atgtacaggcacggcatatcttcccaaagatcttggccactatggactacgatctttatttttcttggagtggcggcaatcttgggagtaaccattggtcttcttgttcattttctggcagttgagaagacttactattatcaaggtgattttcatatttctggagtcacatacaatgataattgtgaaaacgcagcttcacaagccagcacaaatctaagcaaagatattgagactaagatgttaaatgcatttcaaaattccagtatatataaggaatatgtcaaatctgaggtcatcaaacttctgcctaatgccaatggttcaaatgtgcagttacagctgaaattcaagtttcctccagcagaaggagttagcatgaggactaaaatcaaggctaaattacatcagatgttgaaaaacaacatggcatcctggaatgcagttcctgcttccattaaactcatggaaatcagcaaggctgcttctgaaatgcttaccaacaactgttgtgggagacaagtagccaacagtatcataactggcaacaaaattgtgaatggaaaaagctccctggagggggcatggccatggcaggccagcatgcaatggaaaggccgtcactactgtggagcctctctgatcagcagcaggtggctattatctgcagctcactgctttgctaagaaaaataattcaaaagattggactgtcaactttggagttgtagtaaataaaccatatatgacacggaaagtccaaaacattatttttcatgaaaattatagcagtcctgggcttcatgatgatattgcccttgtgcagcttgctgaagaagtttcttttacagagtacattcgtaagatttgtcttcctgaagccaaaatgaagctctcagaaaatgacaatgttgtagttacaggttggggaacactttatatgaatggttcatttccagtgatacttcaagaagcctttttgaagattattgacaacaaaatttgcaatgcctcatatgcatactctggctttgtgactgattcaatgttatgtgctggatttatgtcaggagaagctgatgcatgtcagaatgattctggtggaccactagcttaccctgattccagaaatatctggcatcttgttggaatagtaagctggggtgatggatgtggtaaaaagaataagccaggtgtctatactcgagtgacttcttatcgcaattggattacatccaagactggactctga

Sequence Length

1251

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

116496976

NCBI GeneID

132724

Molecular Weight

46,337 Da

NCBI Official Full Name

Homo sapiens transmembrane protease, serine 11B, mRNA

NCBI Official Synonym Full Names

transmembrane protease, serine 11B

NCBI Official Symbol

TMPRSS11B

NCBI Protein Information

transmembrane protease serine 11B

UniProt Protein Name

Transmembrane protease serine 11B

Protein Family

Transmembrane protease serine

UniProt Gene Name

TMPRSS11B

UniProt Synonym Gene Names

HATL5

UniProt Entry Name

TM11B_HUMAN

Uniprot Description

TMPRSS11B: Probable serine protease. Belongs to the peptidase S1 family.

Protein type: Membrane protein, integral; Protease; EC 3.4.21.-

Chromosomal Location of Human Ortholog: 4q13.2

Cellular Component: plasma membrane

Molecular Function: serine-type peptidase activity

Research Articles on TMPRSS11B

1. Data indicate that TMPRSS11b (BC126195), encoding human airway trypsin-like protease 5 (HATL5), is localized on the cell surface of differentiated epithelial cells in the stratified squamous epithelia of cervix, esophagus, and oral cavity.

Similar Products

Product Notes

The TMPRSS11B tmprss11b (Catalog #AAA1278964) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtacaggc acggcatatc ttcccaaaga tcttggccac tatggactac gatctttatt tttcttggag tggcggcaat cttgggagta accattggtc ttcttgttca ttttctggca gttgagaaga cttactatta tcaaggtgat tttcatattt ctggagtcac atacaatgat aattgtgaaa acgcagcttc acaagccagc acaaatctaa gcaaagatat tgagactaag atgttaaatg catttcaaaa ttccagtata tataaggaat atgtcaaatc tgaggtcatc aaacttctgc ctaatgccaa tggttcaaat gtgcagttac agctgaaatt caagtttcct ccagcagaag gagttagcat gaggactaaa atcaaggcta aattacatca gatgttgaaa aacaacatgg catcctggaa tgcagttcct gcttccatta aactcatgga aatcagcaag gctgcttctg aaatgcttac caacaactgt tgtgggagac aagtagccaa cagtatcata actggcaaca aaattgtgaa tggaaaaagc tccctggagg gggcatggcc atggcaggcc agcatgcaat ggaaaggccg tcactactgt ggagcctctc tgatcagcag caggtggcta ttatctgcag ctcactgctt tgctaagaaa aataattcaa aagattggac tgtcaacttt ggagttgtag taaataaacc atatatgaca cggaaagtcc aaaacattat ttttcatgaa aattatagca gtcctgggct tcatgatgat attgcccttg tgcagcttgc tgaagaagtt tcttttacag agtacattcg taagatttgt cttcctgaag ccaaaatgaa gctctcagaa aatgacaatg ttgtagttac aggttgggga acactttata tgaatggttc atttccagtg atacttcaag aagccttttt gaagattatt gacaacaaaa tttgcaatgc ctcatatgca tactctggct ttgtgactga ttcaatgtta tgtgctggat ttatgtcagg agaagctgat gcatgtcaga atgattctgg tggaccacta gcttaccctg attccagaaa tatctggcat cttgttggaa tagtaagctg gggtgatgga tgtggtaaaa agaataagcc aggtgtctat actcgagtga cttcttatcg caattggatt acatccaaga ctggactctg a. It is sometimes possible for the material contained within the vial of "TMPRSS11B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

TMPRSS11B cdna clone