Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SRP9 cdna clone

SRP9 cDNA Clone

Gene Names
SRP9; ALURBP
Synonyms
SRP9; SRP9 cDNA Clone; SRP9 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgcagtaccagacctgggaggagttcagccgcgctgccgagaagctttacctcgctgaccctatgaaggcacgtgtggttctcaaatataggcattctgatgggaacttgtgtgttaaagtaacagatgatttagttagacagtgtcttgctctattgctcaggctgcagtgcagtggcatgatcatggctcactgcatcctcgacctcctgggctcaagcggtcctcttgcttcagcctcctga
Sequence Length
249
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,124 Da
NCBI Official Full Name
Homo sapiens signal recognition particle 9kDa, mRNA
NCBI Official Synonym Full Names
signal recognition particle 9
NCBI Official Symbol
SRP9
NCBI Official Synonym Symbols
ALURBP
NCBI Protein Information
signal recognition particle 9 kDa protein
UniProt Protein Name
Signal recognition particle 9 kDa protein
UniProt Gene Name
SRP9
UniProt Synonym Gene Names
SRP9
UniProt Entry Name
SRP09_HUMAN

Uniprot Description

SRP9: Signal-recognition-particle assembly has a crucial role in targeting secretory proteins to the rough endoplasmic reticulum membrane. SRP9 together with SRP14 and the Alu portion of the SRP RNA, constitutes the elongation arrest domain of SRP. The complex of SRP9 and SRP14 is required for SRP RNA binding. Belongs to the SRP9 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Translation; RNA-binding

Chromosomal Location of Human Ortholog: 1q42.12

Cellular Component: cytosol; signal recognition particle receptor complex; signal recognition particle, endoplasmic reticulum targeting

Molecular Function: protein binding; RNA binding; signal recognition particle binding

Biological Process: SRP-dependent cotranslational protein targeting to membrane; SRP-dependent cotranslational protein targeting to membrane, translocation

Research Articles on SRP9

Similar Products

Product Notes

The SRP9 srp9 (Catalog #AAA1278772) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgcagt accagacctg ggaggagttc agccgcgctg ccgagaagct ttacctcgct gaccctatga aggcacgtgt ggttctcaaa tataggcatt ctgatgggaa cttgtgtgtt aaagtaacag atgatttagt tagacagtgt cttgctctat tgctcaggct gcagtgcagt ggcatgatca tggctcactg catcctcgac ctcctgggct caagcggtcc tcttgcttca gcctcctga. It is sometimes possible for the material contained within the vial of "SRP9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.