Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HNRNPH2 cdna clone

HNRNPH2 cDNA Clone

Gene Names
HNRNPH2; FTP3; HNRPH'; HNRPH2; hnRNPH'
Synonyms
HNRNPH2; HNRNPH2 cDNA Clone; HNRNPH2 cdna clone
Ordering
For Research Use Only!
Sequence
atgatgctgagcacggaaggcagggaggggttcgtggtgaaggtcaggggcctaccctggtcctgctcagccgatgaagtgatgcgcttcttctctgattgcaagatccaaaatggcacatcaggtattcgtttcatctacaccagagaaggcagaccaagtggtgaagcatttgttgaacttgaatctgaagaggaagtgaaattggctttgaagaaggacagagaaaccatgggacacagatacgttgaagtattcaagtctaacagtgttgaaatggattgggtgttgaagcatacaggtccgaatagccctgatactgccaacgatggcttcgtccggcttagaggactcccatttggctgtagcaaggaagagattgttcagttcttttcagggttggaaattgtgccaaatgggatgacactgccagtggactttcaggggcgaagcacaggggaagcctttgtgcagtttgcttcacaggagatagctgagaaggccttaaagaaacacaaggaaagaatagggcacaggtacattgagatcttcaagagtagccgagctgaagttcgaacccactatgatccccctcgaaagctcatggctatgcagcggccaggtccctatgataggccgggggctggcagagggtataatagcattggcagaggagctgggtttgaaaggatgaggcgtggtgcctatggtggagggtatggaggctatgatgactatggtggctataatgatggatatggctttgggtctgatagatttggaagagacctcaattactgtttttcaggaatgtctgatcatagatacggagatggtgggtccagtttccagagcaccacagggcactgtgtacacatgagggggttaccttacagagccactgagaatgatatttataatttcttctcacctcttaatcccatgagagtacatattgaaattggacccgatggcagagttaccggtgaggcagatgttgaatttgctactcatgaagatgctgtggcagctatggcaaaagacaaagctaatatgcaacacagatatgtggagctcttcttaaattctactgcaggaacaagtgggggtgcttacgatcacagctatgtagaactttttttgaattctacagcaggggcaagtggtggcgcttatggtagccaaatgatgggagggatgggcttatccaaccagtctagttatggaggtcctgctagccagcagctgagtggtggttatggaggtggttatggtggtcagagcagtatgagtggatatgaccaagttctgcaggaaaactccagtgactatcagtcaaaccttgcttag
Sequence Length
1350
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,264 Da
NCBI Official Full Name
Homo sapiens heterogeneous nuclear ribonucleoprotein H2 (H'), mRNA
NCBI Official Synonym Full Names
heterogeneous nuclear ribonucleoprotein H2 (H')
NCBI Official Symbol
HNRNPH2
NCBI Official Synonym Symbols
FTP3; HNRPH'; HNRPH2; hnRNPH'
NCBI Protein Information
heterogeneous nuclear ribonucleoprotein H2
UniProt Protein Name
Heterogeneous nuclear ribonucleoprotein H2
UniProt Gene Name
HNRNPH2
UniProt Synonym Gene Names
FTP3; HNRPH2; hnRNP H2; hnRNP H'
UniProt Entry Name
HNRH2_HUMAN

NCBI Description

This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that binds to RNAs. It is very similar to the family member HNRPH1. This gene is thought to be involved in Fabray disease and X-linked agammaglobulinemia phenotype. Alternative splicing results in multiple transcript variants encoding the same protein. Read-through transcription between this locus and the ribosomal protein L36a gene has been observed. [provided by RefSeq, Jan 2011]

Uniprot Description

hnRNP H2: This protein is a component of the heterogeneous nuclear ribonucleoprotein (hnRNP) complexes which provide the substrate for the processing events that pre-mRNAs undergo before becoming functional, translatable mRNAs in the cytoplasm. Binds poly(RG).

Protein type: RNA-binding; RNA splicing

Chromosomal Location of Human Ortholog: Xq22

Cellular Component: cytoplasm; membrane; nucleoplasm; nucleus; ribonucleoprotein complex

Molecular Function: protein binding; RNA binding

Biological Process: gene expression; nuclear mRNA splicing, via spliceosome

Research Articles on HNRNPH2

Similar Products

Product Notes

The HNRNPH2 hnrnph2 (Catalog #AAA1278595) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgctga gcacggaagg cagggagggg ttcgtggtga aggtcagggg cctaccctgg tcctgctcag ccgatgaagt gatgcgcttc ttctctgatt gcaagatcca aaatggcaca tcaggtattc gtttcatcta caccagagaa ggcagaccaa gtggtgaagc atttgttgaa cttgaatctg aagaggaagt gaaattggct ttgaagaagg acagagaaac catgggacac agatacgttg aagtattcaa gtctaacagt gttgaaatgg attgggtgtt gaagcataca ggtccgaata gccctgatac tgccaacgat ggcttcgtcc ggcttagagg actcccattt ggctgtagca aggaagagat tgttcagttc ttttcagggt tggaaattgt gccaaatggg atgacactgc cagtggactt tcaggggcga agcacagggg aagcctttgt gcagtttgct tcacaggaga tagctgagaa ggccttaaag aaacacaagg aaagaatagg gcacaggtac attgagatct tcaagagtag ccgagctgaa gttcgaaccc actatgatcc ccctcgaaag ctcatggcta tgcagcggcc aggtccctat gataggccgg gggctggcag agggtataat agcattggca gaggagctgg gtttgaaagg atgaggcgtg gtgcctatgg tggagggtat ggaggctatg atgactatgg tggctataat gatggatatg gctttgggtc tgatagattt ggaagagacc tcaattactg tttttcagga atgtctgatc atagatacgg agatggtggg tccagtttcc agagcaccac agggcactgt gtacacatga gggggttacc ttacagagcc actgagaatg atatttataa tttcttctca cctcttaatc ccatgagagt acatattgaa attggacccg atggcagagt taccggtgag gcagatgttg aatttgctac tcatgaagat gctgtggcag ctatggcaaa agacaaagct aatatgcaac acagatatgt ggagctcttc ttaaattcta ctgcaggaac aagtgggggt gcttacgatc acagctatgt agaacttttt ttgaattcta cagcaggggc aagtggtggc gcttatggta gccaaatgat gggagggatg ggcttatcca accagtctag ttatggaggt cctgctagcc agcagctgag tggtggttat ggaggtggtt atggtggtca gagcagtatg agtggatatg accaagttct gcaggaaaac tccagtgact atcagtcaaa ccttgcttag. It is sometimes possible for the material contained within the vial of "HNRNPH2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.