Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NECAP1 cdna clone

NECAP1 cDNA Clone

Gene Names
NECAP1; EIEE21
Synonyms
NECAP1; NECAP1 cDNA Clone; NECAP1 cdna clone
Ordering
For Research Use Only!
Sequence
atggatgctcgtcctaagttggatctgggcttcaaggaaggacaaaccatcaagttgtgtatcgggaacattacaaacaagaaaggaggtgcttctaagcccaggactgcaaggggtgggggtctgagcttactcccacccccgccaggaggcaaagtcactattcccccaccatcctcctcagttgccatcagcaatcatgtcaccccaccacccattccgaaatctaaccatggaggcagtgatgcagatatccttttagatttggattctcctgctcctgtcacgacaccagcaccaactccagtttctgtaagcaatgacttgtggggagacttcagcactgcctccagctctgttccaaaccaggcaccacagccatccaactgggtccagttctga
Sequence Length
402
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
11,444 Da
NCBI Official Full Name
Homo sapiens NECAP endocytosis associated 1, mRNA
NCBI Official Synonym Full Names
NECAP endocytosis associated 1
NCBI Official Symbol
NECAP1
NCBI Official Synonym Symbols
EIEE21
NCBI Protein Information
adaptin ear-binding coat-associated protein 1
UniProt Protein Name
Adaptin ear-binding coat-associated protein 1
UniProt Gene Name
NECAP1
UniProt Synonym Gene Names
NECAP-1
UniProt Entry Name
NECP1_HUMAN

NCBI Description

This gene encodes a protein containing two characteristic WXXF motifs. The encoded protein localizes to clathrin-coated vesicles, where it binds components of the adapter protein complexes and aids in endocytosis. Loss of function of this gene results in early infantile epileptic encephalopathy-21. There is a pseudogene for this gene on chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]

Uniprot Description

NECAP1: Involved in endocytosis. Belongs to the NECAP family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Vesicle

Chromosomal Location of Human Ortholog: 12p13.31

Disease: Epileptic Encephalopathy, Early Infantile, 21

Research Articles on NECAP1

Similar Products

Product Notes

The NECAP1 necap1 (Catalog #AAA1278085) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatgctc gtcctaagtt ggatctgggc ttcaaggaag gacaaaccat caagttgtgt atcgggaaca ttacaaacaa gaaaggaggt gcttctaagc ccaggactgc aaggggtggg ggtctgagct tactcccacc cccgccagga ggcaaagtca ctattccccc accatcctcc tcagttgcca tcagcaatca tgtcacccca ccacccattc cgaaatctaa ccatggaggc agtgatgcag atatcctttt agatttggat tctcctgctc ctgtcacgac accagcacca actccagttt ctgtaagcaa tgacttgtgg ggagacttca gcactgcctc cagctctgtt ccaaaccagg caccacagcc atccaactgg gtccagttct ga. It is sometimes possible for the material contained within the vial of "NECAP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.