Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SF3B2 cdna clone

SF3B2 cDNA Clone

Gene Names
SF3B2; Cus1; SF3b1; SAP145; SF3B145; SF3b150
Synonyms
SF3B2; SF3B2 cDNA Clone; SF3B2 cdna clone
Ordering
For Research Use Only!
Sequence
atggatgacccctctgtgggccccaagatcccccaggctttggagaagatcctgcagctgaaggagagccgccaggaagagatgaattctcagcaggaggaagaggaaatggaaacagatgctcgctcgtccctgggccagtcagcgtcagagactgaggaggacacagtgtccgtatctaaaaaggagaaaaaccggaagcgtaggaaccgaaagaagaagaaaaagccccagcgggtgcgaggggtgtcctctgagagctctggggaccgggagaaagactcaacccggtcccgtggctctgattccccagcagctgatgttgagattgagtatgtgactgaagaacctgaaatttacgagcccaactttatcttctttaagaggatctttgaggcttttaagctcactgatgatgtgaagaaggagaaagagaaagagccagagaaacttgacaaactggagaactctgcagcccccaagaagaagggatttgaagaggagcacaaggacagtgatgatgacagcagtgatgacgagcaggaaaagaagccagaagcccccaagctgtccaagaagaagttgcgccgaatgaaccgcttcactgtggctgaactcaagcagctggtggctcggcccgatgtcgtggagatgcacgatgtgacagcgcaggaccctaagctcttggttcacctcaaggccactcggaactctgtgcctgtgccacgccactggtgttttaagcgcaaatacctgcagggcaaacggggcattgagaagccccccttcgagctgccagacttcatcaaacgcacaggcatccaggagatgcgagaggccctgcaggagaaggaagaacagaagaccatgaagtcaaaaatgcgagagaaagttcggcctaagatgggcaaaattgacatcgactaccagaaactgcatgatgccttcttcaagtggcagaccaagccaaagctgaccatccatggggacctgtactatgaggggaaggagttcgagacacgactgaaggagaagaagccaggagatctgtctgatgagctaaggatttccttggggatgccagtaggaccaaatgcccacaaggtccctcccccatggctgattgccatgcagcgatatggaccacccccatcgtatcccaacctgaaaatccctgggctgaactcgcccatccctgagagctgttcctttgggtaccatgctggtggctggggcaaacctccagtggatgagactgggaaaccgctctatggggacgtgtttggaaccaatgctgctgaatttcagaccaagactgaggaagaagagattgatcggaccccttggggggaactggaaccatctgatgaagaatcctcagaagaagaggaagaggaagaaagtgatgaagacaaaccagatgagacaggctttattacccctgcagacagtggccttatcactcctggaggcttttcatcagtgcctgctggaatggagacccctgaactcattgagctgaggaagaagaagattgaggaggcgatggacggaagtgagacacctcagctcttcactgtgttgccagagaagagaacagccactgttggaggggccatgatgggatcaacccacatttatgacatgtccacggttatgagccggaagggcccggctcctgagctgcaaggtgtggaagtggcgctggcgcctgaagagttggagctggatcctatggccatgacccagaagtatgaggagcatgtgcgggagcagcaggctcaagtagagaaggaggacttcagtgacatggtggctgagcacgctgccaaacagaagcaaaaaaaacggaaagctcagccccaggacagccgtgggggcagcaagaaatataaggagttcaagttttag
Sequence Length
1911
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
100,228 Da
NCBI Official Full Name
Homo sapiens splicing factor 3b, subunit 2, 145kDa, mRNA
NCBI Official Synonym Full Names
splicing factor 3b subunit 2
NCBI Official Symbol
SF3B2
NCBI Official Synonym Symbols
Cus1; SF3b1; SAP145; SF3B145; SF3b150
NCBI Protein Information
splicing factor 3B subunit 2
UniProt Protein Name
Splicing factor 3B subunit 2
Protein Family
UniProt Gene Name
SF3B2
UniProt Synonym Gene Names
SAP145; SF3b145; SAP 145
UniProt Entry Name
SF3B2_HUMAN

NCBI Description

This gene encodes subunit 2 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence-independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. Subunit 2 associates with pre-mRNA upstream of the branch site at the anchoring site. Subunit 2 also interacts directly with subunit 4 of the splicing factor 3b complex. Subunit 2 is a highly hydrophilic protein with a proline-rich N-terminus and a glutamate-rich stretch in the C-terminus. [provided by RefSeq, Jul 2008]

Uniprot Description

SF3B2: subunit of the splicing factor SF3B required for 'A' complex assembly formed by the stable binding of U2 snRNP to the branchpoint sequence (bps) in pre-mRNA. Sequence independent binding of SF3A/SF3B complex upstream of the branch site is essential, it may anchor U2 snRNP to the pre-mRNA. May also be involved in the assembly of the 'E' complex. Belongs also to the minor U12-dependent spliceosome, which is involved in the splicing of rare class of nuclear pre-mRNA intron.

Protein type: RNA splicing; RNA-binding; RNA processing; Spliceosome

Chromosomal Location of Human Ortholog: 11q13.1

Cellular Component: nucleoplasm; snRNP U2; spliceosome; U12-dependent spliceosome

Molecular Function: protein binding

Biological Process: mRNA processing; nuclear mRNA splicing, via spliceosome; RNA splicing

Research Articles on SF3B2

Similar Products

Product Notes

The SF3B2 sf3b2 (Catalog #AAA1277934) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatgacc cctctgtggg ccccaagatc ccccaggctt tggagaagat cctgcagctg aaggagagcc gccaggaaga gatgaattct cagcaggagg aagaggaaat ggaaacagat gctcgctcgt ccctgggcca gtcagcgtca gagactgagg aggacacagt gtccgtatct aaaaaggaga aaaaccggaa gcgtaggaac cgaaagaaga agaaaaagcc ccagcgggtg cgaggggtgt cctctgagag ctctggggac cgggagaaag actcaacccg gtcccgtggc tctgattccc cagcagctga tgttgagatt gagtatgtga ctgaagaacc tgaaatttac gagcccaact ttatcttctt taagaggatc tttgaggctt ttaagctcac tgatgatgtg aagaaggaga aagagaaaga gccagagaaa cttgacaaac tggagaactc tgcagccccc aagaagaagg gatttgaaga ggagcacaag gacagtgatg atgacagcag tgatgacgag caggaaaaga agccagaagc ccccaagctg tccaagaaga agttgcgccg aatgaaccgc ttcactgtgg ctgaactcaa gcagctggtg gctcggcccg atgtcgtgga gatgcacgat gtgacagcgc aggaccctaa gctcttggtt cacctcaagg ccactcggaa ctctgtgcct gtgccacgcc actggtgttt taagcgcaaa tacctgcagg gcaaacgggg cattgagaag ccccccttcg agctgccaga cttcatcaaa cgcacaggca tccaggagat gcgagaggcc ctgcaggaga aggaagaaca gaagaccatg aagtcaaaaa tgcgagagaa agttcggcct aagatgggca aaattgacat cgactaccag aaactgcatg atgccttctt caagtggcag accaagccaa agctgaccat ccatggggac ctgtactatg aggggaagga gttcgagaca cgactgaagg agaagaagcc aggagatctg tctgatgagc taaggatttc cttggggatg ccagtaggac caaatgccca caaggtccct cccccatggc tgattgccat gcagcgatat ggaccacccc catcgtatcc caacctgaaa atccctgggc tgaactcgcc catccctgag agctgttcct ttgggtacca tgctggtggc tggggcaaac ctccagtgga tgagactggg aaaccgctct atggggacgt gtttggaacc aatgctgctg aatttcagac caagactgag gaagaagaga ttgatcggac cccttggggg gaactggaac catctgatga agaatcctca gaagaagagg aagaggaaga aagtgatgaa gacaaaccag atgagacagg ctttattacc cctgcagaca gtggccttat cactcctgga ggcttttcat cagtgcctgc tggaatggag acccctgaac tcattgagct gaggaagaag aagattgagg aggcgatgga cggaagtgag acacctcagc tcttcactgt gttgccagag aagagaacag ccactgttgg aggggccatg atgggatcaa cccacattta tgacatgtcc acggttatga gccggaaggg cccggctcct gagctgcaag gtgtggaagt ggcgctggcg cctgaagagt tggagctgga tcctatggcc atgacccaga agtatgagga gcatgtgcgg gagcagcagg ctcaagtaga gaaggaggac ttcagtgaca tggtggctga gcacgctgcc aaacagaagc aaaaaaaacg gaaagctcag ccccaggaca gccgtggggg cagcaagaaa tataaggagt tcaagtttta g. It is sometimes possible for the material contained within the vial of "SF3B2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.