Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

VPS39 cdna clone

VPS39 cDNA Clone

Gene Names
VPS39; TLP; VAM6; hVam6p
Synonyms
VPS39; VPS39 cDNA Clone; VPS39 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgtggtgtgaaaattctatctgtgtgggtttcaagagagactactacctaataagggtggatggaaaggggtccatcaaagagctctttccaacaggaaaacagctggagcccttagttgcacctctggcagatggaaaagtggctgtgggccaggatgatctcaccgtggtactcaatgaggaagggatctgcacacagaaatgtgccctgaactggacggacataccagtggccatggagcaccagcctccctacatcattgcagtgttgcctcgatatgttgagatccgaacatttgaaccgaggcttctggtccaaagcattgaattgcaaaggccccgtttcattacctcaggaggatcaaacattatctatgtggccagcaatcattttgtttggagactcatccctgtccccatggcaacccaaatccaacaacttctccaggacaagcagtttgaattggctctgcagctcgcagaaatgaaagatgattctgacagtgaaaagcagcaacaaattcatcacatcaagaacttgtatgccttcaacctcttctgccagaagcgttttgatgagtccatgcaggtctttgctaaacttggcacagatcccacccatgtgatgggcctgtaccctgacctgctgcccacagactacagaaagcagttgcagtatcccaacccattgcctgtgctctccggggctgaattggagaaggctcacttagctctgattgactacctgacacagaaacgaagtcaattggtaaagaagctgaatgactctgatcaccagtcaagcacctcaccgctcatggaaggcactcccaccatcaaatccaagaagaagctgctacaaatcatcgacaccaccctgctcaagtgctatctccatacaaatgtggccctggtggcccccttgctacgcctggagaacaatcactgccacatcgaggagagcgagcacgtgctaaagaaggctcacaagtacagtgagcttatcatcctgtatgagaagaaggggctccacgagaaagctctgcaggtgctcgtggaccagtccaagaaagccaactcccctctgaaaggccacgagaggacagtgcagtatctgcagcatctgggcacagaaaacctgcatttgattttctcctactcagtgtgggtgctgagagacttcccagaagatggcctgaagatatttactgaagatctcccggaagtggagtctctgccacgtgatcgagtcctcggcttcttaatagagaattttaagggtctggctattccttatctggaacacatcatccatgtttgggaggagacaggctctcggttccacaactgcctgatccagctatactgtgagaaggtgcaaggtctgatgaaggagtatctcctgtccttccctgcaggcaaaaccccagtcccagctggagaggaagagggtgagctgggagaataccggcaaaagctcctcatgttcttggagatttccagctactatgatccaggccggctcatctgtgattttccctttgatggcctcttagaagaacgagctctcctgttggggcgcatggggaaacatgaacaagctcttttcatttatgtccacatcttgaaggatacaaggatggctgaggagtactgccacaaacactatgaccgaaacaaagatggcaacaaagatgtgtatctgtccctgcttcggatgtacctgtcgccccccagcattcactgcctggggccaatcaagctggaactactggagccaaaagccaacctccaggccgctctgcaggtcctcgagctacaccacagcaaactggacaccaccaaggccctcaaccttctgccagcaaacactcagatcaatgacatacgcatcttcctggaaaaggtcttggaagaaaatgcacaaaagaaacggttcaatcaagtgctcaagaaccttctccatgcagaattcctgagggtccaggaagagcggattttacaccagcaggtgaagtgcatcatcacagaggagaaggtgtgcatggtgtgtaagaagaagattgggaacagtgcatttgcaagataccccaatggagtggtcgtccattacttctgttccaaagaggtaaacccagctgacacttga
Sequence Length
2154
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
100,769 Da
NCBI Official Full Name
Homo sapiens vacuolar protein sorting 39 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
VPS39, HOPS complex subunit
NCBI Official Symbol
VPS39
NCBI Official Synonym Symbols
TLP; VAM6; hVam6p
NCBI Protein Information
vam6/Vps39-like protein
UniProt Protein Name
Vam6/Vps39-like protein
Protein Family
UniProt Gene Name
VPS39
UniProt Synonym Gene Names
KIAA0770; TLP; VAM6; hVam6p
UniProt Entry Name
VPS39_HUMAN

NCBI Description

This gene encodes a protein that may promote clustering and fusion of late endosomes and lysosomes. The protein may also act as an adaptor protein that modulates the transforming growth factor-beta response by coupling the transforming growth factor-beta receptor complex to the Smad pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

Uniprot Description

VPS39: May play a role in clustering and fusion of late endosomes and lysosomes. Regulator of TGF-beta/activin signaling, inhibiting SMAD3- and activating SMAD2-dependent transcription. Acts by interfering with SMAD3/SMAD4 complex formation, this would lead to inhibition of SMAD3-dependent transcription and relieve SMAD3 inhibition of SMAD2-dependent promoters, thus increasing SMAD2-dependent transcription. Does not affect TGF-beta-induced SMAD2 or SMAD3 phosphorylation, nor SMAD2/SMAD4 complex formation. Belongs to the VAM6/VPS39 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: G protein regulator, misc.; Membrane protein, peripheral

Chromosomal Location of Human Ortholog: 15q15.1

Cellular Component: late endosome membrane; lysosomal membrane

Biological Process: autophagy; endosomal vesicle fusion; endosome to lysosome transport

Research Articles on VPS39

Similar Products

Product Notes

The VPS39 vps39 (Catalog #AAA1277634) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtggt gtgaaaattc tatctgtgtg ggtttcaaga gagactacta cctaataagg gtggatggaa aggggtccat caaagagctc tttccaacag gaaaacagct ggagccctta gttgcacctc tggcagatgg aaaagtggct gtgggccagg atgatctcac cgtggtactc aatgaggaag ggatctgcac acagaaatgt gccctgaact ggacggacat accagtggcc atggagcacc agcctcccta catcattgca gtgttgcctc gatatgttga gatccgaaca tttgaaccga ggcttctggt ccaaagcatt gaattgcaaa ggccccgttt cattacctca ggaggatcaa acattatcta tgtggccagc aatcattttg tttggagact catccctgtc cccatggcaa cccaaatcca acaacttctc caggacaagc agtttgaatt ggctctgcag ctcgcagaaa tgaaagatga ttctgacagt gaaaagcagc aacaaattca tcacatcaag aacttgtatg ccttcaacct cttctgccag aagcgttttg atgagtccat gcaggtcttt gctaaacttg gcacagatcc cacccatgtg atgggcctgt accctgacct gctgcccaca gactacagaa agcagttgca gtatcccaac ccattgcctg tgctctccgg ggctgaattg gagaaggctc acttagctct gattgactac ctgacacaga aacgaagtca attggtaaag aagctgaatg actctgatca ccagtcaagc acctcaccgc tcatggaagg cactcccacc atcaaatcca agaagaagct gctacaaatc atcgacacca ccctgctcaa gtgctatctc catacaaatg tggccctggt ggcccccttg ctacgcctgg agaacaatca ctgccacatc gaggagagcg agcacgtgct aaagaaggct cacaagtaca gtgagcttat catcctgtat gagaagaagg ggctccacga gaaagctctg caggtgctcg tggaccagtc caagaaagcc aactcccctc tgaaaggcca cgagaggaca gtgcagtatc tgcagcatct gggcacagaa aacctgcatt tgattttctc ctactcagtg tgggtgctga gagacttccc agaagatggc ctgaagatat ttactgaaga tctcccggaa gtggagtctc tgccacgtga tcgagtcctc ggcttcttaa tagagaattt taagggtctg gctattcctt atctggaaca catcatccat gtttgggagg agacaggctc tcggttccac aactgcctga tccagctata ctgtgagaag gtgcaaggtc tgatgaagga gtatctcctg tccttccctg caggcaaaac cccagtccca gctggagagg aagagggtga gctgggagaa taccggcaaa agctcctcat gttcttggag atttccagct actatgatcc aggccggctc atctgtgatt ttccctttga tggcctctta gaagaacgag ctctcctgtt ggggcgcatg gggaaacatg aacaagctct tttcatttat gtccacatct tgaaggatac aaggatggct gaggagtact gccacaaaca ctatgaccga aacaaagatg gcaacaaaga tgtgtatctg tccctgcttc ggatgtacct gtcgcccccc agcattcact gcctggggcc aatcaagctg gaactactgg agccaaaagc caacctccag gccgctctgc aggtcctcga gctacaccac agcaaactgg acaccaccaa ggccctcaac cttctgccag caaacactca gatcaatgac atacgcatct tcctggaaaa ggtcttggaa gaaaatgcac aaaagaaacg gttcaatcaa gtgctcaaga accttctcca tgcagaattc ctgagggtcc aggaagagcg gattttacac cagcaggtga agtgcatcat cacagaggag aaggtgtgca tggtgtgtaa gaagaagatt gggaacagtg catttgcaag ataccccaat ggagtggtcg tccattactt ctgttccaaa gaggtaaacc cagctgacac ttga. It is sometimes possible for the material contained within the vial of "VPS39, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.