CPEB4 cdna clone
CPEB4 cDNA Clone
Gene Names
CPEB4; CPE-BP4; hCPEB-4
Synonyms
CPEB4; CPEB4 cDNA Clone; CPEB4 cdna clone
Sequence
atgggggattacgggtttggagtgctagtgcaaagcaatactgggaataaatctgcttttccagtcagattccatccacatctgcagcctccacaccatcaccaaaatgccacccccagccctgctgcttttataaataataacacagctgccaatggcagcagtgctgggtcagcttggctttttcctgctccagctacccataacattcaggatgagatcttggggtcagaaaaagcaaaaagtcagcaacaggaacagcaagaccccttagaaaagcagcagctttccccaagtccaggtcaggaagctggaatactgcctgaaacagagaaggcaaaatcagaagaaaatcaaggggacaattcttcggaaaatggcaatgggaaggagaaaataaggatcgaatctccagtgttgacagggtttgattatcaagaagccactgggctaggtacttcaacccaacccttgacatctagcgcatcgtctcttactggtttcagtaactggtcagcagcgatagcgccttcctcctctacaataatcaatgaagatgcaagtttctttcaccagggaggggtccctgctgcttcggctaataacggtgctctgttgtttcaaaatttcccccatcatgtcagccctggctttggaggcagcttctctcctcagatcgggcctctctcacagcaccacccacatcaccctcatttccagcatcatcacagccagcatcagcagcaaaggaggtctcctgccagtccccatcccccacccttcacacatagaaatgctgcttttaaccagctgcctcatttggcgaataatcttaacaaacccccctctccgtggagcagctaccagagtccgtcaccaacaccctcctcttcctggagcccgggcggtggtggatatggtggctggggaggttcccaaggccgagatcaccgcagagggctgaatggtggaataacgcccctgaactccatctcgcctttgaagaaaaattttgcaagcaatcatattcagctccagaagtatgctcgccccagctctgcctttgcacctaaatcctggatggaagatagcttgaacagggctgacaacatttttccttttccggatcgccccaggacattcgacatgcactcactggagagttcactcattgacataatgagagctgaaaatgataccattaaaggtcgtctaaactattcatatccaggatccgatagctctctgcttattaatgcaaggacatatgggcgaaggagaggtcagtcttcactgtttccaatggaagatggattcttggatgatggccgtggggatcagcctcttcatagtggcctgggttcacctcactgcttcagtcaccagaatggggaaagagtggaacgatattctcgaaaggtgtttgtaggcggattgcctccagacattgatgaagatgagatcacagctagttttcgtcgctttggccctctgattgtggattggcctcataaagctgagagcaaatcctattttcctcctaaaggctatgcattcctgctgtttcaagatgaaagctctgtgcaggctctcattgatgcatgcattgaagaagatggaaaactctacctttgtgtatcaagtcccactatcaaggataagccagtccagattcggccttggaatctcagtgacagtgactttgtgatggatggttcacagccacttgacccacgaaaaactatatttgttggtggtgttcctcgaccattacgagctgtggagcttgcgatgataatggatcggctatatggaggtgtgtgctacgctgggattgataccgaccctgagctaaaatacccaaaaggagctgggagagttgcgttctctaatcaacagagttacatagctgctatcagtgcccgctttgttcagctgcagcatggagagatagataaacgggtggaagttaagccatatgtcttggatgatcagctgtgtgatgaatgtcagggggcccgttgtggggggaaatttgctccatttttctgtgctaatgttacctgtctgcagtattactgtgaatattgctgggctgctatccattctcgtgctggcagggaattccacaagcccctggtgaaggaaggcggtgaccgccctcggcatatttcattccgctggaactaa
Sequence Length
2190
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
36,212 Da
NCBI Official Full Name
Homo sapiens cytoplasmic polyadenylation element binding protein 4, mRNA
NCBI Official Synonym Full Names
cytoplasmic polyadenylation element binding protein 4
NCBI Official Symbol
CPEB4
NCBI Official Synonym Symbols
CPE-BP4; hCPEB-4
NCBI Protein Information
cytoplasmic polyadenylation element-binding protein 4
UniProt Protein Name
Cytoplasmic polyadenylation element-binding protein 4
Protein Family
UniProt Gene Name
CPEB4
UniProt Synonym Gene Names
KIAA1673; CPE-BP4; CPE-binding protein 4; hCPEB-4
UniProt Entry Name
CPEB4_HUMAN
Uniprot Description
CPEB4: Belongs to the RRM CPEB family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: RNA-binding
Chromosomal Location of Human Ortholog: 5q21
Cellular Component: cytoplasm; dendrite; endoplasmic reticulum; neuron projection; nucleus; postsynaptic density; synapse
Molecular Function: mRNA 3'-UTR binding; protein binding; ribosome binding; translation factor activity, nucleic acid binding; translation repressor activity, nucleic acid binding
Biological Process: cellular response to glucose starvation; ionotropic glutamate receptor signaling pathway; negative regulation of neuron apoptosis
Research Articles on CPEB4
Similar Products
Product Notes
The CPEB4 cpeb4 (Catalog #AAA1277545) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggggatt acgggtttgg agtgctagtg caaagcaata ctgggaataa atctgctttt ccagtcagat tccatccaca tctgcagcct ccacaccatc accaaaatgc cacccccagc cctgctgctt ttataaataa taacacagct gccaatggca gcagtgctgg gtcagcttgg ctttttcctg ctccagctac ccataacatt caggatgaga tcttggggtc agaaaaagca aaaagtcagc aacaggaaca gcaagacccc ttagaaaagc agcagctttc cccaagtcca ggtcaggaag ctggaatact gcctgaaaca gagaaggcaa aatcagaaga aaatcaaggg gacaattctt cggaaaatgg caatgggaag gagaaaataa ggatcgaatc tccagtgttg acagggtttg attatcaaga agccactggg ctaggtactt caacccaacc cttgacatct agcgcatcgt ctcttactgg tttcagtaac tggtcagcag cgatagcgcc ttcctcctct acaataatca atgaagatgc aagtttcttt caccagggag gggtccctgc tgcttcggct aataacggtg ctctgttgtt tcaaaatttc ccccatcatg tcagccctgg ctttggaggc agcttctctc ctcagatcgg gcctctctca cagcaccacc cacatcaccc tcatttccag catcatcaca gccagcatca gcagcaaagg aggtctcctg ccagtcccca tcccccaccc ttcacacata gaaatgctgc ttttaaccag ctgcctcatt tggcgaataa tcttaacaaa cccccctctc cgtggagcag ctaccagagt ccgtcaccaa caccctcctc ttcctggagc ccgggcggtg gtggatatgg tggctgggga ggttcccaag gccgagatca ccgcagaggg ctgaatggtg gaataacgcc cctgaactcc atctcgcctt tgaagaaaaa ttttgcaagc aatcatattc agctccagaa gtatgctcgc cccagctctg cctttgcacc taaatcctgg atggaagata gcttgaacag ggctgacaac atttttcctt ttccggatcg ccccaggaca ttcgacatgc actcactgga gagttcactc attgacataa tgagagctga aaatgatacc attaaaggtc gtctaaacta ttcatatcca ggatccgata gctctctgct tattaatgca aggacatatg ggcgaaggag aggtcagtct tcactgtttc caatggaaga tggattcttg gatgatggcc gtggggatca gcctcttcat agtggcctgg gttcacctca ctgcttcagt caccagaatg gggaaagagt ggaacgatat tctcgaaagg tgtttgtagg cggattgcct ccagacattg atgaagatga gatcacagct agttttcgtc gctttggccc tctgattgtg gattggcctc ataaagctga gagcaaatcc tattttcctc ctaaaggcta tgcattcctg ctgtttcaag atgaaagctc tgtgcaggct ctcattgatg catgcattga agaagatgga aaactctacc tttgtgtatc aagtcccact atcaaggata agccagtcca gattcggcct tggaatctca gtgacagtga ctttgtgatg gatggttcac agccacttga cccacgaaaa actatatttg ttggtggtgt tcctcgacca ttacgagctg tggagcttgc gatgataatg gatcggctat atggaggtgt gtgctacgct gggattgata ccgaccctga gctaaaatac ccaaaaggag ctgggagagt tgcgttctct aatcaacaga gttacatagc tgctatcagt gcccgctttg ttcagctgca gcatggagag atagataaac gggtggaagt taagccatat gtcttggatg atcagctgtg tgatgaatgt cagggggccc gttgtggggg gaaatttgct ccatttttct gtgctaatgt tacctgtctg cagtattact gtgaatattg ctgggctgct atccattctc gtgctggcag ggaattccac aagcccctgg tgaaggaagg cggtgaccgc cctcggcata tttcattccg ctggaactaa. It is sometimes possible for the material contained within the vial of "CPEB4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
