Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GCAT cdna clone

GCAT cDNA Clone

Gene Names
GCAT; KBL
Synonyms
GCAT; GCAT cDNA Clone; GCAT cdna clone
Ordering
For Research Use Only!
Sequence
atgtggcctgggaacgcctggcgcgccgcactcttctgggtgccccgcggccgccgcgcacagtcagcgctggcccagctgcgtggcattctggagggggagctggaaggcatctgcggagctggcacttggaagagtgagcgggtcatcacgtcccgtcaggggccgcacatccgcgtggacggcgtctccggaggaatccttaacttctgtgccaacaactacctgggcctgagcagccaccctgaggtgatccaggcaggtctgcaggctctggaggagtttggagctggcctcagctctgtccgctttatctgtggaacccagagcatccacaagaatctagaagcaaaaatagcccgcttccaccagcgggaggatgccatcctctatcccagctgttatgacgccaacgccggcctctttgaggccctgctgaccccagaggacgcagtcctgtcggacgagctgaaccatgcctccatcatcgacggcatccggctgtgcaaggcccacaagtaccgctatcgccacctggacatggccgacctagaagccaagctgcaggaggcccagaagcatcggctgcgcctggtggccactgatggggccttttccatggatggcgacatcgcacccctgcaggagatctgctgcctcgcctctagatatggtgccctggtcttcatggatgaatgccatgccactggcttcctggggcccacaggacggggcacagatgagctgctgggtgtgatggaccaggtcaccatcatcaactccaccctggggaaggccctgggtggagcatcagggggctacacgacagggcctgggcccctggtgtccctgctgcggcagcgcgcccggccatacctcttctccaacagtctgccacctgctgtcgttggctgcgcctccaaggccctagatctgctgatggggagtaacaccattgtccagtctatggctgccaagacccagaggttccgtagtaagatggaagctgctggcttcactatctcgggagccagtcaccccatctgccctgtgatgctgggtgatgcccggctggcctctcgcatggcggatgacatgctgaagagaggcatctttgtcatcgggttcagctaccccgtggtccccaagggcaaggcctggatccgggtacagatctcagcagtgcatagcgaggaagacattgaccgctgcgtggaggccttcgtggaagtggggcgactgcacggggcactgccctga
Sequence Length
1260
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,974 Da
NCBI Official Full Name
Homo sapiens glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase), mRNA
NCBI Official Synonym Full Names
glycine C-acetyltransferase
NCBI Official Symbol
GCAT
NCBI Official Synonym Symbols
KBL
NCBI Protein Information
2-amino-3-ketobutyrate coenzyme A ligase, mitochondrial
UniProt Protein Name
2-amino-3-ketobutyrate coenzyme A ligase, mitochondrial
UniProt Gene Name
GCAT
UniProt Synonym Gene Names
KBL; AKB ligase
UniProt Entry Name
KBL_HUMAN

NCBI Description

The degradation of L-threonine to glycine consists of a two-step biochemical pathway involving the enzymes L-threonine dehydrogenase and 2-amino-3-ketobutyrate coenzyme A ligase. L-Threonine is first converted into 2-amino-3-ketobutyrate by L-threonine dehydrogenase. This gene encodes the second enzyme in this pathway, which then catalyzes the reaction between 2-amino-3-ketobutyrate and coenzyme A to form glycine and acetyl-CoA. The encoded enzyme is considered a class II pyridoxal-phosphate-dependent aminotransferase. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 14. [provided by RefSeq, Jan 2010]

Uniprot Description

GCAT: The degradation of L-threonine to glycine consists of a two-step biochemical pathway involving the enzymes L-threonine dehydrogenase and 2-amino-3-ketobutyrate coenzyme A ligase. L-Threonine is first converted into 2-amino-3-ketobutyrate by L-threonine dehydrogenase. This gene encodes the second enzyme in this pathway, which then catalyzes the reaction between 2-amino-3-ketobutyrate and coenzyme A to form glycine and acetyl-CoA. The encoded enzyme is considered a class II pyridoxal-phosphate-dependent aminotransferase. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 14. [provided by RefSeq, Jan 2010]

Protein type: Transferase; Amino Acid Metabolism - glycine, serine and threonine; Mitochondrial; EC 2.3.1.29

Chromosomal Location of Human Ortholog: 22q13.1

Cellular Component: mitochondrial inner membrane; mitochondrion; nucleoplasm

Biological Process: threonine catabolic process to pyruvate

Research Articles on GCAT

Similar Products

Product Notes

The GCAT gcat (Catalog #AAA1277415) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggcctg ggaacgcctg gcgcgccgca ctcttctggg tgccccgcgg ccgccgcgca cagtcagcgc tggcccagct gcgtggcatt ctggaggggg agctggaagg catctgcgga gctggcactt ggaagagtga gcgggtcatc acgtcccgtc aggggccgca catccgcgtg gacggcgtct ccggaggaat ccttaacttc tgtgccaaca actacctggg cctgagcagc caccctgagg tgatccaggc aggtctgcag gctctggagg agtttggagc tggcctcagc tctgtccgct ttatctgtgg aacccagagc atccacaaga atctagaagc aaaaatagcc cgcttccacc agcgggagga tgccatcctc tatcccagct gttatgacgc caacgccggc ctctttgagg ccctgctgac cccagaggac gcagtcctgt cggacgagct gaaccatgcc tccatcatcg acggcatccg gctgtgcaag gcccacaagt accgctatcg ccacctggac atggccgacc tagaagccaa gctgcaggag gcccagaagc atcggctgcg cctggtggcc actgatgggg ccttttccat ggatggcgac atcgcacccc tgcaggagat ctgctgcctc gcctctagat atggtgccct ggtcttcatg gatgaatgcc atgccactgg cttcctgggg cccacaggac ggggcacaga tgagctgctg ggtgtgatgg accaggtcac catcatcaac tccaccctgg ggaaggccct gggtggagca tcagggggct acacgacagg gcctgggccc ctggtgtccc tgctgcggca gcgcgcccgg ccatacctct tctccaacag tctgccacct gctgtcgttg gctgcgcctc caaggcccta gatctgctga tggggagtaa caccattgtc cagtctatgg ctgccaagac ccagaggttc cgtagtaaga tggaagctgc tggcttcact atctcgggag ccagtcaccc catctgccct gtgatgctgg gtgatgcccg gctggcctct cgcatggcgg atgacatgct gaagagaggc atctttgtca tcgggttcag ctaccccgtg gtccccaagg gcaaggcctg gatccgggta cagatctcag cagtgcatag cgaggaagac attgaccgct gcgtggaggc cttcgtggaa gtggggcgac tgcacggggc actgccctga. It is sometimes possible for the material contained within the vial of "GCAT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.