Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL4 cdna clone

IL4 cDNA Clone

Gene Names
IL4; BSF1; IL-4; BCGF1; BSF-1; BCGF-1
Synonyms
IL4; IL4 cDNA Clone; IL4 cdna clone
Ordering
For Research Use Only!
Sequence
atgggtctcacctcccaactgcttccccctctgttcttcctgctagcatgtgccggcaactttgtccacggacacaagtgcgatatcaccttacaggagatcatcaaaactttgaacagcctcacagagcagaagactctgtgcaccgagttgaccgtaacagacatctttgctgcctccaagaacacaactgagaaggaaaccttctgcagggctgcgactgtgctccggcagttctacagccaccatgagaaggacactcgctgcctgggtgcgactgcacagcagttccacaggcacaagcagctgatccgattcctgaaacggctcgacaggaacctctggggcctggcgggcttgaattcctgtcctgtgaaggaagccaaccagagtacgttggaaaacttcttggaaaggctaaagacgatcatgagagagaaatattcaaagtgttcgagctga
Sequence Length
462
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,797 Da
NCBI Official Full Name
Homo sapiens interleukin 4, mRNA
NCBI Official Synonym Full Names
interleukin 4
NCBI Official Symbol
IL4
NCBI Official Synonym Symbols
BSF1; IL-4; BCGF1; BSF-1; BCGF-1
NCBI Protein Information
interleukin-4
UniProt Protein Name
Interleukin-4
Protein Family
UniProt Gene Name
IL4
UniProt Synonym Gene Names
IL-4; BSF-1
UniProt Entry Name
IL4_HUMAN

NCBI Description

The protein encoded by this gene is a pleiotropic cytokine produced by activated T cells. This cytokine is a ligand for interleukin 4 receptor. The interleukin 4 receptor also binds to IL13, which may contribute to many overlapping functions of this cytokine and IL13. STAT6, a signal transducer and activator of transcription, has been shown to play a central role in mediating the immune regulatory signal of this cytokine. This gene, IL3, IL5, IL13, and CSF2 form a cytokine gene cluster on chromosome 5q, with this gene particularly close to IL13. This gene, IL13 and IL5 are found to be regulated coordinately by several long-range regulatory elements in an over 120 kilobase range on the chromosome. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]

Uniprot Description

IL4: Participates in at least several B-cell activation processes as well as of other cell types. It is a costimulator of DNA-synthesis. It induces the expression of class II MHC molecules on resting B-cells. It enhances both secretion and cell surface expression of IgE and IgG1. It also regulates the expression of the low affinity Fc receptor for IgE (CD23) on both lymphocytes and monocytes. Genetic variations in IL4 may be a cause of susceptibility to ischemic stroke (ISCHSTR); also known as cerebrovascular accident or cerebral infarction. A stroke is an acute neurologic event leading to death of neural tissue of the brain and resulting in loss of motor, sensory and/or cognitive function. Ischemic strokes, resulting from vascular occlusion, is considered to be a highly complex disease consisting of a group of heterogeneous disorders with multiple genetic and environmental risk factors. Belongs to the IL-4/IL-13 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted, signal peptide; Secreted; Cell cycle regulation; Motility/polarity/chemotaxis; Cytokine

Chromosomal Location of Human Ortholog: 5q31.1

Cellular Component: extracellular space

Molecular Function: cytokine activity; interleukin-4 receptor binding; protein binding

Biological Process: B cell differentiation; cellular defense response; chemotaxis; cholesterol metabolic process; connective tissue growth factor biosynthetic process; immune response; myeloid dendritic cell differentiation; negative regulation of apoptosis; negative regulation of osteoclast differentiation; negative regulation of transcription, DNA-dependent; positive regulation of B cell proliferation; positive regulation of interleukin-13 production; positive regulation of isotype switching to IgE isotypes; positive regulation of isotype switching to IgG isotypes; positive regulation of MHC class II biosynthetic process; positive regulation of T cell differentiation; positive regulation of T cell proliferation; positive regulation of transcription factor activity; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; regulation of immune response; regulation of isotype switching; regulation of phosphorylation; T-helper 2 type immune response

Disease: Stroke, Ischemic

Research Articles on IL4

Similar Products

Product Notes

The IL4 il4 (Catalog #AAA1277375) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtctca cctcccaact gcttccccct ctgttcttcc tgctagcatg tgccggcaac tttgtccacg gacacaagtg cgatatcacc ttacaggaga tcatcaaaac tttgaacagc ctcacagagc agaagactct gtgcaccgag ttgaccgtaa cagacatctt tgctgcctcc aagaacacaa ctgagaagga aaccttctgc agggctgcga ctgtgctccg gcagttctac agccaccatg agaaggacac tcgctgcctg ggtgcgactg cacagcagtt ccacaggcac aagcagctga tccgattcct gaaacggctc gacaggaacc tctggggcct ggcgggcttg aattcctgtc ctgtgaagga agccaaccag agtacgttgg aaaacttctt ggaaaggcta aagacgatca tgagagagaa atattcaaag tgttcgagct ga. It is sometimes possible for the material contained within the vial of "IL4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.