Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TFAM cdna clone

TFAM cDNA Clone

Gene Names
TFAM; TCF6; MTTF1; MTTFA; TCF6L1; TCF6L2; TCF6L3
Synonyms
TFAM; TFAM cDNA Clone; TFAM cdna clone
Ordering
For Research Use Only!
Sequence
atggcgtttctccgaagcatgtggggcgtgctgagtgccctgggaaggtctggagcagagctgtgcaccggctgtggaagtcgactgcgctcccccttcagttttgtgtatttaccgaggtggttttcatctgtcttggcaagttgtccaaagaaacctgtaagttcttaccttcgattttctaaagaacaactacccatatttaaagctcagaacccagatgcaaaaactacagaactaattagaagaattgcccagcgttggagggaacttcctgattcaaagaaaaaaatatatcaagatgcttatagggcggagtggcaggtatataaagaagagataagcagatttaaagaacagctaactccaagtcagattatgtctttggaaaaagaaatcatggacaaacatttaaaaaggaaagctatgacaaaaaaaaaagagttaacactgcttggaaaaccaaaaagacctcgttcagcttataacgtttatgtagctgaaagattccaagaagctaagggtgattcaccgcaggaaaagctgaagactgtaaaggaaaactggaaaaatctgtctgactctgaaaaggaattatatattcagcatgctaaagaggacgaaactcgttatcataatgaaatgaagtcttgggaagaacaaatgattgaagttggacgaaaggatcttctacgtcgcacaataaagaaacaacgaaaatatggtgctgaggagtgttaa
Sequence Length
741
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
Mass (Da):29,097
NCBI Official Full Name
Homo sapiens transcription factor A, mitochondrial, mRNA
NCBI Official Synonym Full Names
transcription factor A, mitochondrial
NCBI Official Symbol
TFAM
NCBI Official Synonym Symbols
TCF6; MTTF1; MTTFA; TCF6L1; TCF6L2; TCF6L3
NCBI Protein Information
transcription factor A, mitochondrial
UniProt Protein Name
Transcription factor A, mitochondrial
Protein Family
UniProt Gene Name
TFAM
UniProt Synonym Gene Names
TCF6; TCF6L2; mtTFA; MtTF1; TCF-6
UniProt Entry Name
TFAM_HUMAN

NCBI Description

This gene encodes a key mitochondrial transcription factor containing two high mobility group motifs. The encoded protein also functions in mitochondrial DNA replication and repair. Sequence polymorphisms in this gene are associated with Alzheimer's and Parkinson's diseases. There are pseudogenes for this gene on chromosomes 6, 7, and 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]

Uniprot Description

TFAM: regulates mitochondrial transcription. Induced in humans by caloric restriction. Required for accurate and efficient promoter recognition by the mitochondrial RNA polymerase. Activates transcription by binding immediately upstream of transcriptional start sites. Is able to unwind and bend DNA. Involved in cisplatin resistance. Interacts with TFB1M and TFB2M.

Protein type: DNA-binding; Transcription regulation

Chromosomal Location of Human Ortholog: 10q21

Cellular Component: cytosol; mitochondrial matrix; mitochondrion; nucleus

Molecular Function: chromatin binding; DNA bending activity; protein binding; transcription factor activity

Biological Process: DNA-dependent DNA replication; mitochondrion organization and biogenesis; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; regulation of transcription from RNA polymerase I promoter; transcription from mitochondrial promoter; transcription initiation from mitochondrial promoter

Research Articles on TFAM

Similar Products

Product Notes

The TFAM tfam (Catalog #AAA1276975) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtttc tccgaagcat gtggggcgtg ctgagtgccc tgggaaggtc tggagcagag ctgtgcaccg gctgtggaag tcgactgcgc tcccccttca gttttgtgta tttaccgagg tggttttcat ctgtcttggc aagttgtcca aagaaacctg taagttctta ccttcgattt tctaaagaac aactacccat atttaaagct cagaacccag atgcaaaaac tacagaacta attagaagaa ttgcccagcg ttggagggaa cttcctgatt caaagaaaaa aatatatcaa gatgcttata gggcggagtg gcaggtatat aaagaagaga taagcagatt taaagaacag ctaactccaa gtcagattat gtctttggaa aaagaaatca tggacaaaca tttaaaaagg aaagctatga caaaaaaaaa agagttaaca ctgcttggaa aaccaaaaag acctcgttca gcttataacg tttatgtagc tgaaagattc caagaagcta agggtgattc accgcaggaa aagctgaaga ctgtaaagga aaactggaaa aatctgtctg actctgaaaa ggaattatat attcagcatg ctaaagagga cgaaactcgt tatcataatg aaatgaagtc ttgggaagaa caaatgattg aagttggacg aaaggatctt ctacgtcgca caataaagaa acaacgaaaa tatggtgctg aggagtgtta a. It is sometimes possible for the material contained within the vial of "TFAM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.