Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HLA-G cdna clone

HLA-G cDNA Clone

Gene Names
HLA-G; MHC-G
Synonyms
HLA-G; HLA-G cDNA Clone; HLA-G cdna clone
Ordering
For Research Use Only!
Sequence
atggtggtcatggcaccccgaaccctcttcctgctactctcgggggccctgaccctgaccgagacctgggcgggctcccactccatgaggtatttcagcgccgccgtgtcccggcccagccgcggggagccccgcttcatcgccatgggctacgtggacgacacgcagttcgtgcggttcgacagcgactcggcgtgtccgaggatggagccgcgggcgccgtgggtggagcgggaggggccagagtattgggaagaggagacacggaacaccaaggcccacgcacagactgacagaatgaacctgcagaccctgcgcggctactacaaccagagcgaggccagttctcataccctccagtggatgattggctgcgacctggggtccgacggacgcctcctccgcgggtatgaacagtatgcctacgatggcaaggattacctcgccctgaacgaggacctgcgctcctggaccgcagcggacactgcggctcagatctccaagcgcaagtgtgaggcggccaatgtggctgaacaaaggagagcctacctggagggcacgtgcgtggagtggctccacagatacctggagaacgggaaggagatgctgcagcgcgcggacccccccaagacacacgtgacccaccaccctgtctttgactatgaggccaccctgaggtgctgggccctgggcttctaccctgcggagatcatactgacctggcagcgggatggggaggaccagacccaggacgtggagctcgtggagaccaagcctgcaggggatggaaccttccagaagtgggcagctgtggtggtgccttctggagaggagcagagatacacgtgccatgtgcagcatgaggggctgccggagcccctcatgctgagatggaagcagtcttccctgcccaccatccccatcatgggtatcgttgctggtctggttgtccttgcagctgtagtcactggagctgcggtcgctgctgtgctgtggaggaagaagagctcagattga
Sequence Length
1017
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,224 Da
NCBI Official Full Name
Homo sapiens major histocompatibility complex, class I, G, mRNA
NCBI Official Synonym Full Names
major histocompatibility complex, class I, G
NCBI Official Symbol
HLA-G
NCBI Official Synonym Symbols
MHC-G
NCBI Protein Information
HLA class I histocompatibility antigen, alpha chain G
UniProt Protein Name
HLA class I histocompatibility antigen, alpha chain G
UniProt Gene Name
HLA-G
UniProt Synonym Gene Names
HLA-6.0; HLAG
UniProt Entry Name
HLAG_HUMAN

NCBI Description

HLA-G belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. HLA-G is expressed on fetal derived placental cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domain, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exon 6 encodes the cytoplasmic tail. [provided by RefSeq, Jul 2008]

Uniprot Description

HLA-G: Involved in the presentation of foreign antigens to the immune system. Plays a role in maternal tolerance of the fetus by mediating protection from the deleterious effects of natural killer cells, cytotoxic T-lymphocytes, macrophages and mononuclear cells. Belongs to the MHC class I family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 6p21.3

Cellular Component: early endosome membrane; Golgi membrane; membrane; phagocytic vesicle membrane; plasma membrane

Molecular Function: antigen binding; protein homodimerization activity; receptor binding

Biological Process: antigen processing and presentation; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent; antigen processing and presentation of peptide antigen via MHC class I; cellular defense response; immune response-inhibiting cell surface receptor signaling pathway; negative regulation of immune response; negative regulation of T cell proliferation; positive regulation of interleukin-12 production; positive regulation of regulatory T cell differentiation; positive regulation of T cell tolerance induction; positive regulation of tolerance induction; regulation of immune response

Disease: Asthma, Susceptibility To

Research Articles on HLA-G

Similar Products

Product Notes

The HLA-G hla-g (Catalog #AAA1276922) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtggtca tggcaccccg aaccctcttc ctgctactct cgggggccct gaccctgacc gagacctggg cgggctccca ctccatgagg tatttcagcg ccgccgtgtc ccggcccagc cgcggggagc cccgcttcat cgccatgggc tacgtggacg acacgcagtt cgtgcggttc gacagcgact cggcgtgtcc gaggatggag ccgcgggcgc cgtgggtgga gcgggagggg ccagagtatt gggaagagga gacacggaac accaaggccc acgcacagac tgacagaatg aacctgcaga ccctgcgcgg ctactacaac cagagcgagg ccagttctca taccctccag tggatgattg gctgcgacct ggggtccgac ggacgcctcc tccgcgggta tgaacagtat gcctacgatg gcaaggatta cctcgccctg aacgaggacc tgcgctcctg gaccgcagcg gacactgcgg ctcagatctc caagcgcaag tgtgaggcgg ccaatgtggc tgaacaaagg agagcctacc tggagggcac gtgcgtggag tggctccaca gatacctgga gaacgggaag gagatgctgc agcgcgcgga cccccccaag acacacgtga cccaccaccc tgtctttgac tatgaggcca ccctgaggtg ctgggccctg ggcttctacc ctgcggagat catactgacc tggcagcggg atggggagga ccagacccag gacgtggagc tcgtggagac caagcctgca ggggatggaa ccttccagaa gtgggcagct gtggtggtgc cttctggaga ggagcagaga tacacgtgcc atgtgcagca tgaggggctg ccggagcccc tcatgctgag atggaagcag tcttccctgc ccaccatccc catcatgggt atcgttgctg gtctggttgt ccttgcagct gtagtcactg gagctgcggt cgctgctgtg ctgtggagga agaagagctc agattga. It is sometimes possible for the material contained within the vial of "HLA-G, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.