Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIM22 cdna clone

TRIM22 cDNA Clone

Gene Names
TRIM22; RNF94; STAF50; GPSTAF50
Synonyms
TRIM22; TRIM22 cDNA Clone; TRIM22 cdna clone
Ordering
For Research Use Only!
Sequence
atggatttctcagtaaaggtagacatagagaaggaggtgacctgccccatctgcctggagctcctgacagaacctctgagcctagattgtggccacagcttctgccaagcctgcatcactgcaaagatcaaggagtcagtgatcatctcaagaggggaaagcagctgtcctgtgtgtcagaccagattccagcctgggaacctccgacctaatcggcatctggccaacatagttgagagagtcaaagaggtcaagatgagcccacaggaggggcagaagagagatgtctgtgagcaccatggaaaaaaactccagatcttctgtaaggaggatggaaaagtcatttgctgggtttgtgaactgtctcaggaacaccaaggtcaccaaacattccgcataaacgaggtggtcaaggaatgtcaggaaaagctgcaggtagccctgcagaggctgataaaggaggatcaagaggctgagaagctggaagatgacatcagacaagagagaaccgcctggaagaattatatccagatcgagagacagaagattctgaaagggttcaatgaaatgagagtcatcttggacaatgaggagcagagagagctgcaaaagctggaggaaggtgaggtgaatgtgctggacaacctggcagcagctacagaccagctggtccagcagaggcaggatgccagcacgctcatctcagatctccagcggaggttgaggggatcgtcagtagagatgctgcaggatgtgattgacgtcatgaaaaggagtgaaagctggacattgaagaagccaaaatctgtttccaagaaactaaagagtgtattccgagtaccagatctgagtgggatgctgcaagttcttaaagagctgacagatgtccagtactactgggtggacgtgatgctgaatccaggcagtgccacttcgaatgttgctatttctgtggatcagagacaagtgaaaactgtacgcacctgcacatttaagaattcaaatccatgtgatttttctgcttttggtgtcttcggctgccaatatttctcttcggggaaatattactgggaagtagatgtgtctggaaagattgcctggatcctgggcgtacacagtaaaataagtagtctgaataaaaggaagagctctgggtttgcttttgatccaagtgtaaattattcaaaagtttactccagatatagacctcaatatggctactgggttataggattacagaatacatgtgaatataatgcttttgaggactcctcctcttctgatcccaaggttttgactctctttatggctgtgcctccctgtcgtattggggttttcctagactatgaggcaggcattgtctcatttttcaatgtcacaaaccacggagcactcatctacaagttctctggatgtcgcttttctcgacctgcttatccgtatttcaatccttggaactgcctagtccccatgactgtgtgcccaccgagctcctga
Sequence Length
1497
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,429 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 22, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 22
NCBI Official Symbol
TRIM22
NCBI Official Synonym Symbols
RNF94; STAF50; GPSTAF50
NCBI Protein Information
E3 ubiquitin-protein ligase TRIM22
UniProt Protein Name
E3 ubiquitin-protein ligase TRIM22
UniProt Gene Name
TRIM22
UniProt Synonym Gene Names
RNF94; STAF50
UniProt Entry Name
TRI22_HUMAN

NCBI Description

The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to the cytoplasm and its expression is induced by interferon. The protein down-regulates transcription from the HIV-1 LTR promoter region, suggesting that function of this protein may be to mediate interferon's antiviral effects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]

Uniprot Description

TRIM22: Interferon-induced antiviral protein involved in cell innate immunity. The antiviral activity could in part be mediated by TRIM22-dependent ubiquitination of viral proteins. Plays a role in restricting the replication of HIV-1, encephalomyocarditis virus (EMCV) and hepatitis B virus (HBV). Acts as a transcriptional repressor of HBV core promoter. May have E3 ubiquitin-protein ligase activity. Belongs to the TRIM/RBCC family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin ligase; Ligase; Transcription, coactivator/corepressor; Ubiquitin conjugating system; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 11p15

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus

Molecular Function: protein binding; protein binding, bridging; protein kinase binding; transcription corepressor activity; transcription factor activity

Biological Process: activation of NF-kappaB transcription factor; immune response; positive regulation of autophagy; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of transcription factor activity; regulation of protein localization; regulation of transcription, DNA-dependent; response to virus

Research Articles on TRIM22

Similar Products

Product Notes

The TRIM22 trim22 (Catalog #AAA1276855) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatttct cagtaaaggt agacatagag aaggaggtga cctgccccat ctgcctggag ctcctgacag aacctctgag cctagattgt ggccacagct tctgccaagc ctgcatcact gcaaagatca aggagtcagt gatcatctca agaggggaaa gcagctgtcc tgtgtgtcag accagattcc agcctgggaa cctccgacct aatcggcatc tggccaacat agttgagaga gtcaaagagg tcaagatgag cccacaggag gggcagaaga gagatgtctg tgagcaccat ggaaaaaaac tccagatctt ctgtaaggag gatggaaaag tcatttgctg ggtttgtgaa ctgtctcagg aacaccaagg tcaccaaaca ttccgcataa acgaggtggt caaggaatgt caggaaaagc tgcaggtagc cctgcagagg ctgataaagg aggatcaaga ggctgagaag ctggaagatg acatcagaca agagagaacc gcctggaaga attatatcca gatcgagaga cagaagattc tgaaagggtt caatgaaatg agagtcatct tggacaatga ggagcagaga gagctgcaaa agctggagga aggtgaggtg aatgtgctgg acaacctggc agcagctaca gaccagctgg tccagcagag gcaggatgcc agcacgctca tctcagatct ccagcggagg ttgaggggat cgtcagtaga gatgctgcag gatgtgattg acgtcatgaa aaggagtgaa agctggacat tgaagaagcc aaaatctgtt tccaagaaac taaagagtgt attccgagta ccagatctga gtgggatgct gcaagttctt aaagagctga cagatgtcca gtactactgg gtggacgtga tgctgaatcc aggcagtgcc acttcgaatg ttgctatttc tgtggatcag agacaagtga aaactgtacg cacctgcaca tttaagaatt caaatccatg tgatttttct gcttttggtg tcttcggctg ccaatatttc tcttcgggga aatattactg ggaagtagat gtgtctggaa agattgcctg gatcctgggc gtacacagta aaataagtag tctgaataaa aggaagagct ctgggtttgc ttttgatcca agtgtaaatt attcaaaagt ttactccaga tatagacctc aatatggcta ctgggttata ggattacaga atacatgtga atataatgct tttgaggact cctcctcttc tgatcccaag gttttgactc tctttatggc tgtgcctccc tgtcgtattg gggttttcct agactatgag gcaggcattg tctcattttt caatgtcaca aaccacggag cactcatcta caagttctct ggatgtcgct tttctcgacc tgcttatccg tatttcaatc cttggaactg cctagtcccc atgactgtgt gcccaccgag ctcctga. It is sometimes possible for the material contained within the vial of "TRIM22, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.