NFKBID cdna clone

NFKBID cDNA Clone

Cat. Num. AAA1276441

• Gene Names: NFKBID; TA-NFKBH; IkappaBNS
• Synonyms: NFKBID; NFKBID cDNA Clone; NFKBID cdna clone

• Sequence: atgaggtcttgctgtgttgtccaggctggtctgcagctcctggcctcaagtgatcctccttcttcagcttcccaaagtgctaggattacaggcgtgaaccaccgcactccgccaagggagatcaagagcaacaagacagttctgcacttggccgtgcaggctgccaaccccactctggttcagctgctgctggagctgccccggggagacctgcggacctttgtcaacatgaaggcccacgggaacacagccctccacatggcggctgccctgccccctgggccggcccaggaggccatcgtgcggcacctgttggcagctggggcggaccccacactgcgcaacctggagaatgagcagcccgttcacctgctgcggcccgggccgggccctgaggggctccggcagctgttgaagaggagccgtgtggcgccgccaggcctgtcctcttag
• Sequence Length: 453

• Vector: pENTR223.1 or pUC
• Clone Sequence Report: Provided with product shipment

NCBI and Uniprot Product Information

• NCBI GI #: 34782947
• NCBI GeneID: 84807
• Molecular Weight: 15,921 Da
• NCBI Official Full Name: Homo sapiens nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta, mRNA
• NCBI Official Synonym Full Names: NFKB inhibitor delta
• NCBI Official Symbol: NFKBID
• NCBI Official Synonym Symbols: TA-NFKBH; IkappaBNS
• NCBI Protein Information: NF-kappa-B inhibitor delta
• UniProt Protein Name: NF-kappa-B inhibitor delta
• Protein Family: NF-kappa-B inhibitor
• UniProt Gene Name: NFKBID
• UniProt Synonym Gene Names: IKBNS; IkB-delta; IkappaBdelta
• UniProt Entry Name: IKBD_HUMAN

Uniprot Description

NFKBID: May regulate the expression of IL-2, IL-6, and other cytokines through regulation on NF-kappa-B activity. Functions in the regulation of inflammatory responses. May also regulate TCR- induced negative selection of thymocytes. Belongs to the NF-kappa-B inhibitor family. 3 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 19q13.12

Cellular Component: nucleus

Molecular Function: protein binding; transcription cofactor activity

Biological Process: regulation of transcription from RNA polymerase II promoter