Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAX cdna clone

MAX cDNA Clone

Gene Names
MAX; bHLHd4
Synonyms
MAX; MAX cDNA Clone; MAX cdna clone
Ordering
For Research Use Only!
Sequence
atgagcgataacgatgacatcgaggtggagagcgacgaagagcaaccgaggtttcaatctgcggctgacaaacgggctcatcataatgcactggaacgaaaacgtagggaccacatcaaagacagctttcacagtttgcgggactcagtcccatcactccaaggagagaagctctatttcctcttttggaaattgtgtactcctgtccttcatcgtcaaagtttgatgcagaaatgccacaccttcatttcaagctaccaagtgcacaagaaaaaagaatgcaagatttaa
Sequence Length
291
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,599 Da
NCBI Official Full Name
Homo sapiens MYC associated factor X, mRNA
NCBI Official Synonym Full Names
MYC associated factor X
NCBI Official Symbol
MAX
NCBI Official Synonym Symbols
bHLHd4
NCBI Protein Information
protein max
UniProt Protein Name
Protein max
Protein Family
UniProt Gene Name
MAX
UniProt Synonym Gene Names
BHLHD4; bHLHd4
UniProt Entry Name
MAX_HUMAN

NCBI Description

The protein encoded by this gene is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell proliferation, differentiation and apoptosis. The homodimers and heterodimers compete for a common DNA target site (the E box) and rearrangement among these dimer forms provides a complex system of transcriptional regulation. Mutations of this gene have been reported to be associated with hereditary pheochromocytoma. A pseudogene of this gene is located on the long arm of chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]

Uniprot Description

MAX: a transcription factor. Forms a DNA- binding protein complex with MYC or MAD. The MYC-MAX complex is a transcriptional activator, whereas the MAD-MAX complex is a repressor. CPG methylation of the recognition site greatly inhibits DNA binding, suggesting that DNA methylation may regulate the MYC/MAX complex in vivo. May repress transcription via the recruitment of a chromatin remodeling complex containing H3-K9 histone methyltransferase activity. Three alternatively spliced isoforms have been reported.

Protein type: DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 14q23

Cellular Component: cytoplasm; nucleoplasm; nucleus

Molecular Function: protein binding; transcription coactivator activity; transcription cofactor activity; transcription factor activity

Biological Process: transcription from RNA polymerase II promoter

Research Articles on MAX

Similar Products

Product Notes

The MAX max (Catalog #AAA1275930) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcgata acgatgacat cgaggtggag agcgacgaag agcaaccgag gtttcaatct gcggctgaca aacgggctca tcataatgca ctggaacgaa aacgtaggga ccacatcaaa gacagctttc acagtttgcg ggactcagtc ccatcactcc aaggagagaa gctctatttc ctcttttgga aattgtgtac tcctgtcctt catcgtcaaa gtttgatgca gaaatgccac accttcattt caagctacca agtgcacaag aaaaaagaat gcaagattta a. It is sometimes possible for the material contained within the vial of "MAX, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.