Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C9orf102 cdna clone

C9orf102 cDNA Clone

Gene Names
ERCC6L2; BMFS2; SR278; RAD26L; C9orf102
Synonyms
C9orf102; C9orf102 cDNA Clone; C9orf102 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaatgttcaaatgagaaagttgttaatcaagagcagtcgtatgaatcaatggataaatttttagatggcgttcaggaagtggcttatattcactcaaaccagaatgtaattggatcgagcaaagctgaaaatcacatgagccgatgggcagcacatgacgtatttgagttgaagcagttttctcagctgcctgctaacatagctgtttgcagttctaagacatataaagaaaaagtggatgcagatacattgccacacacaaagaaaggccagcaacctagtgaaggcagcatttcacttcctctttacatttcaaatcctgtaaaccagaagaagaaaaaagtctaccatacaaaccagaccaccttcataattggagaaacaccaaaaggaatccgcagaaaacaatttgaagaaatggcctcttattttaactcgtcttctgtaaacgaatttgctaaacatataaccaatgccacatcagaagaacgacagaaaatgctaagagacttttatgcttctcaatatccagaggtaaaagaattttttgtggattctgtgtcacaattcaacaattcttcctttgagaaaggagagcagcgcacccggaagaaatctgataaaagagaatctcttataaaaccaaggctgtcagattctgaaaccttgtcatttaaagattctaccaacaaaatttctcaagtttgcagcctaaaaacatataaaagaaaatcagttaagtttcagaatcatatttcctatagagaagaggtgttttttaatgatgcagaaactaagaaatcacctgttagttctactcaagagattgacagtgggaaaaacagccaggcatccgaagatactgtgacatcccgttctctgaacagtgagtctgaaacacgtgagagaaggttagaaaataccatgaaagaccaacaggacctcacaagaacgggcatttcaagaaaagaaccccttctcaaattggaaaacaaaaagatagaaaatccagtgctggaaaatacttctgtgataagcttacttggtgatacctctattcttgatgacctttttaaaagtcatgggaacagtcccacacaactgccaaagaaagttctttcagggcccatggaaaaagcaaaacagagaccaaaagatttctgggacatcttgaatgagcagaatgatgagagtcttagtaaactcacagacttggcagtaatagagactctgtgtgaaaaagcacctctagcagcaccctttaaaaggagagaagagccagcaacttctctttggaaatcaaatgagaaatttttatggaagaaatttagcccaagtgatacagatgaaaacgcaaccaatacacagagtaccacataa
Sequence Length
1383
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,174 Da
NCBI Official Full Name
Homo sapiens chromosome 9 open reading frame 102, mRNA
NCBI Official Synonym Full Names
ERCC excision repair 6 like 2
NCBI Official Symbol
ERCC6L2
NCBI Official Synonym Symbols
BMFS2; SR278; RAD26L; C9orf102
NCBI Protein Information
DNA excision repair protein ERCC-6-like 2
UniProt Protein Name
DNA excision repair protein ERCC-6-like 2
UniProt Gene Name
ERCC6L2
UniProt Synonym Gene Names
C9orf102; RAD26L
UniProt Entry Name
ER6L2_HUMAN

NCBI Description

This gene encodes a member of the Snf2 family of helicase-like proteins. The encoded protein may play a role in DNA repair and mitochondrial function. Mutations in this gene have been associated with bone marrow failure syndrome 2. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Apr 2014]

Uniprot Description

RAD26L iso2: Belongs to the SNF2/RAD54 helicase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.6.1.-; EC 3.6.4.-; Hydrolase

Chromosomal Location of Human Ortholog: 9q22.32

Research Articles on C9orf102

Similar Products

Product Notes

The C9orf102 ercc6l2 (Catalog #AAA1275898) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaatgtt caaatgagaa agttgttaat caagagcagt cgtatgaatc aatggataaa tttttagatg gcgttcagga agtggcttat attcactcaa accagaatgt aattggatcg agcaaagctg aaaatcacat gagccgatgg gcagcacatg acgtatttga gttgaagcag ttttctcagc tgcctgctaa catagctgtt tgcagttcta agacatataa agaaaaagtg gatgcagata cattgccaca cacaaagaaa ggccagcaac ctagtgaagg cagcatttca cttcctcttt acatttcaaa tcctgtaaac cagaagaaga aaaaagtcta ccatacaaac cagaccacct tcataattgg agaaacacca aaaggaatcc gcagaaaaca atttgaagaa atggcctctt attttaactc gtcttctgta aacgaatttg ctaaacatat aaccaatgcc acatcagaag aacgacagaa aatgctaaga gacttttatg cttctcaata tccagaggta aaagaatttt ttgtggattc tgtgtcacaa ttcaacaatt cttcctttga gaaaggagag cagcgcaccc ggaagaaatc tgataaaaga gaatctctta taaaaccaag gctgtcagat tctgaaacct tgtcatttaa agattctacc aacaaaattt ctcaagtttg cagcctaaaa acatataaaa gaaaatcagt taagtttcag aatcatattt cctatagaga agaggtgttt tttaatgatg cagaaactaa gaaatcacct gttagttcta ctcaagagat tgacagtggg aaaaacagcc aggcatccga agatactgtg acatcccgtt ctctgaacag tgagtctgaa acacgtgaga gaaggttaga aaataccatg aaagaccaac aggacctcac aagaacgggc atttcaagaa aagaacccct tctcaaattg gaaaacaaaa agatagaaaa tccagtgctg gaaaatactt ctgtgataag cttacttggt gatacctcta ttcttgatga cctttttaaa agtcatggga acagtcccac acaactgcca aagaaagttc tttcagggcc catggaaaaa gcaaaacaga gaccaaaaga tttctgggac atcttgaatg agcagaatga tgagagtctt agtaaactca cagacttggc agtaatagag actctgtgtg aaaaagcacc tctagcagca ccctttaaaa ggagagaaga gccagcaact tctctttgga aatcaaatga gaaattttta tggaagaaat ttagcccaag tgatacagat gaaaacgcaa ccaatacaca gagtaccaca taa. It is sometimes possible for the material contained within the vial of "C9orf102, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.