Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COL9A3 cdna clone

COL9A3 cDNA Clone

Gene Names
COL9A3; IDD; MED; EDM3; DJ885L7.4.1
Synonyms
COL9A3; COL9A3 cDNA Clone; COL9A3 cdna clone
Ordering
For Research Use Only!
Sequence
atggccgggccgcgcgcgtgcgccccgctcctgctcctgctcctgctcggggagcttctggcggccgccggggcgcagagagtgggactccccggcccccccggccccccagggccgcccgggaagcccggccaggacggcattgacggagaagctggtcctccaggtctgcctgggcccccgggaccaaagggggccccaggaaagccggggaaaccaggagaggctgggctgccgggactgccgggtgtggatggtctgactggacgagatggaccccctggacccaagggtgcccctggggaacggggaagtctgggacccccggggccgcccgggctggggggcaaaggcctccctggaccccccggagaggcaggagtgagcggccccccaggtgggatcggcctccgcggccccccgggaccttctggactccccggcctccctggtcccccaggacctcccggaccccctggacacccaggagtcctccctgaaggcgctactgaccttcagtgcccaagtatctgcccgccaggtcccccagggccccctggaatgccagggttcaagggacccactggctacaaaggcgagcagggggaagtcggcaaggacggcgagaagggtgaccctggcccccctgggcccgccggcctcccgggcagcgtggggctgcagggcccccggggattacgaggactgccagggccactcgggccccctggggaccggggtcccattgggttccgagggccgcctgggatcccaggagcgcctgggaaagcgggtgaccgaggcgagaggggcccagaagggttccgcggccccaagggtgacctcggcagacctggtcccaagggaacccccggagtggccgggccaagcggagagccgggcatgccgggcaaggacggccagaatggcgtgccaggactcgatggccagaagggagaggctggtcgcaacggtgctccgggagagaagggccccaacgggctgccgggcctccctggacgagcggggtccaaaggcgagaagggagaacggggcagagctggggagctgggtgaggccggcccctctggagagccaggcgtccctggagatgctggcatgcctggggagcgcggtgaggctggccaccggggctcagcgggggccctcggcccacaaggccctcccggagcccctggtgtccgaggcttccagggccagaagggcagcatgggagaccccggccttccaggcccccagggcctccgaggtgacgtgggcgaccggggtccgggaggtgccgcaggccctaagggagaccagggtattgcaggttccgacggtcttcctggggataaaggagaactgggtcccagcggcctggtcggacccaaaggagagtctggcagtcgaggggagctgggccccaaaggcacccagggtcccaacggcaccagcggtgttcagggtgtccccgggccccccggtcctctgggcctgcagggcgtcccgggtgttcctggcatcacggggaagccgggagttccggggaaggaggccagcgagcagcgcatcagggagctgtgtggggggatgatcagcgaacaaattgcacagttagccgcgcacctaaggaagcctttggcacccgggtccattggtcggcccggtccagctggcccccctgggcccccaggacccccaggctccattggtcaccctggcgctcgaggaccccccggataccgcggtcccactggggagctgggagaccccgggcccagaggaaaccagggtgacagaggagacaaaggcgcggcaggagcagggctggacgggcctgaaggagaccaggggccccaaggaccccaaggcgtgcccggcaccagcaaggacggccaggacggtgctcccggcgagcctgggcctcccggagatcctgggcttccaggtgccattggggcccaggggacaccggggatctgcgacacctcagcctgccaaggagccgtgttaggaggggtcggggagaaatcaggctctcgaagctcataa
Sequence Length
2055
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
63,616 Da
NCBI Official Full Name
Homo sapiens collagen, type IX, alpha 3, mRNA
NCBI Official Synonym Full Names
collagen type IX alpha 3 chain
NCBI Official Symbol
COL9A3
NCBI Official Synonym Symbols
IDD; MED; EDM3; DJ885L7.4.1
NCBI Protein Information
collagen alpha-3(IX) chain
UniProt Protein Name
Collagen alpha-3(IX) chain
Protein Family
UniProt Gene Name
COL9A3
UniProt Entry Name
CO9A3_HUMAN

NCBI Description

This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. Mutations in this gene are associated with multiple epiphyseal dysplasia type 3. [provided by RefSeq, Jan 2010]

Uniprot Description

COL9A3: Structural component of hyaline cartilage and vitreous of the eye. Defects in COL9A3 are the cause of multiple epiphyseal dysplasia type 3 (EDM3); also known as multiple epiphyseal dysplasia with myopathy. EDM is a generalized skeletal dysplasia associated with significant morbidity. Joint pain, joint deformity, waddling gait, and short stature are the main clinical signs and symptoms. EDM is broadly categorized into the more severe Fairbank and the milder Ribbing types. Defects in COL9A3 are a cause of susceptibility to intervertebral disk disease (IDD). A common musculo- skeletal disorder caused by degeneration of intervertebral disks of the lumbar spine. It results in low-back pain and unilateral leg pain. Susceptibility to intervertebral disk disease, is conferred by variant p.Arg103Trp (PubMed:11308397). Belongs to the fibril-associated collagens with interrupted helices (FACIT) family.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 20q13.3

Cellular Component: endoplasmic reticulum lumen; extracellular region

Molecular Function: extracellular matrix structural constituent conferring tensile strength

Biological Process: extracellular matrix organization and biogenesis

Disease: Epiphyseal Dysplasia, Multiple, 3; Intervertebral Disc Disease

Research Articles on COL9A3

Similar Products

Product Notes

The COL9A3 col9a3 (Catalog #AAA1275831) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgggc cgcgcgcgtg cgccccgctc ctgctcctgc tcctgctcgg ggagcttctg gcggccgccg gggcgcagag agtgggactc cccggccccc ccggcccccc agggccgccc gggaagcccg gccaggacgg cattgacgga gaagctggtc ctccaggtct gcctgggccc ccgggaccaa agggggcccc aggaaagccg gggaaaccag gagaggctgg gctgccggga ctgccgggtg tggatggtct gactggacga gatggacccc ctggacccaa gggtgcccct ggggaacggg gaagtctggg acccccgggg ccgcccgggc tggggggcaa aggcctccct ggaccccccg gagaggcagg agtgagcggc cccccaggtg ggatcggcct ccgcggcccc ccgggacctt ctggactccc cggcctccct ggtcccccag gacctcccgg accccctgga cacccaggag tcctccctga aggcgctact gaccttcagt gcccaagtat ctgcccgcca ggtcccccag ggccccctgg aatgccaggg ttcaagggac ccactggcta caaaggcgag cagggggaag tcggcaagga cggcgagaag ggtgaccctg gcccccctgg gcccgccggc ctcccgggca gcgtggggct gcagggcccc cggggattac gaggactgcc agggccactc gggccccctg gggaccgggg tcccattggg ttccgagggc cgcctgggat cccaggagcg cctgggaaag cgggtgaccg aggcgagagg ggcccagaag ggttccgcgg ccccaagggt gacctcggca gacctggtcc caagggaacc cccggagtgg ccgggccaag cggagagccg ggcatgccgg gcaaggacgg ccagaatggc gtgccaggac tcgatggcca gaagggagag gctggtcgca acggtgctcc gggagagaag ggccccaacg ggctgccggg cctccctgga cgagcggggt ccaaaggcga gaagggagaa cggggcagag ctggggagct gggtgaggcc ggcccctctg gagagccagg cgtccctgga gatgctggca tgcctgggga gcgcggtgag gctggccacc ggggctcagc gggggccctc ggcccacaag gccctcccgg agcccctggt gtccgaggct tccagggcca gaagggcagc atgggagacc ccggccttcc aggcccccag ggcctccgag gtgacgtggg cgaccggggt ccgggaggtg ccgcaggccc taagggagac cagggtattg caggttccga cggtcttcct ggggataaag gagaactggg tcccagcggc ctggtcggac ccaaaggaga gtctggcagt cgaggggagc tgggccccaa aggcacccag ggtcccaacg gcaccagcgg tgttcagggt gtccccgggc cccccggtcc tctgggcctg cagggcgtcc cgggtgttcc tggcatcacg gggaagccgg gagttccggg gaaggaggcc agcgagcagc gcatcaggga gctgtgtggg gggatgatca gcgaacaaat tgcacagtta gccgcgcacc taaggaagcc tttggcaccc gggtccattg gtcggcccgg tccagctggc ccccctgggc ccccaggacc cccaggctcc attggtcacc ctggcgctcg aggacccccc ggataccgcg gtcccactgg ggagctggga gaccccgggc ccagaggaaa ccagggtgac agaggagaca aaggcgcggc aggagcaggg ctggacgggc ctgaaggaga ccaggggccc caaggacccc aaggcgtgcc cggcaccagc aaggacggcc aggacggtgc tcccggcgag cctgggcctc ccggagatcc tgggcttcca ggtgccattg gggcccaggg gacaccgggg atctgcgaca cctcagcctg ccaaggagcc gtgttaggag gggtcgggga gaaatcaggc tctcgaagct cataa. It is sometimes possible for the material contained within the vial of "COL9A3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.