Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCL14 cdna clone

CCL14 cDNA Clone

Gene Names
CCL14; CC-1; CC-3; CKB1; MCIF; NCC2; SY14; HCC-1; HCC-3; NCC-2; SCYL2; SCYA14; HCC-1(1-74); HCC-1/HCC-3
Synonyms
CCL14; CCL14 cDNA Clone; CCL14 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagatctccgtggctgccattcccttcttcctcctcatcaccatcgccctagggaccaagactgaatcctcctcacggggaccttaccacccctcagagtgctgcttcacctacactacctacaagatcccgcgtcagcggattatggattactatgagaccaacagccagtgctccaagcccggaattgtcttcatcaccaaaaggggccattccgtctgtaccaaccccagtgacaagtgggtccaggactatatcaaggacatgaaggagaactga
Sequence Length
282
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,297 Da
NCBI Official Full Name
Homo sapiens chemokine (C-C motif) ligand 14, mRNA
NCBI Official Synonym Full Names
C-C motif chemokine ligand 14
NCBI Official Symbol
CCL14
NCBI Official Synonym Symbols
CC-1; CC-3; CKB1; MCIF; NCC2; SY14; HCC-1; HCC-3; NCC-2; SCYL2; SCYA14; HCC-1(1-74); HCC-1/HCC-3
NCBI Protein Information
C-C motif chemokine 14
UniProt Protein Name
C-C motif chemokine 14
Protein Family
UniProt Gene Name
CCL14
UniProt Synonym Gene Names
NCC2; SCYA14; HCC-1/HCC-3
UniProt Entry Name
CCL14_HUMAN

NCBI Description

This gene, chemokine (C-C motif) ligand 14, is one of several CC cytokine genes clustered on 17q11.2. The CC cytokines are secreted proteins characterized by two adjacent cysteines. The cytokine encoded by this gene induces changes in intracellular calcium concentration and enzyme release in monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Read-through transcripts are also expressed that include exons from the upstream cytokine gene, chemokine (C-C motif) ligand 15, and are represented as GeneID: 348249. [provided by RefSeq, Dec 2009]

Uniprot Description

CCL14: Has weak activities on human monocytes and acts via receptors that also recognize MIP-1 alpha. It induced intracellular Ca(2+) changes and enzyme release, but no chemotaxis, at concentrations of 100-1,000 nM, and was inactive on T-lymphocytes, neutrophils, and eosinophil leukocytes. Enhances the proliferation of CD34 myeloid progenitor cells. The processed form HCC-1(9-74) is a chemotactic factor that attracts monocytes eosinophils, and T-cells and is a ligand for CCR1, CCR3 and CCR5. Belongs to the intercrine beta (chemokine CC) family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 17q12

Molecular Function: CCR chemokine receptor binding; chemokine activity

Biological Process: cellular calcium ion homeostasis; G-protein coupled receptor protein signaling pathway; inflammatory response; lymphocyte chemotaxis; monocyte chemotaxis; neutrophil chemotaxis; positive regulation of cell proliferation; positive regulation of GTPase activity; positive regulation of inflammatory response

Research Articles on CCL14

Similar Products

Product Notes

The CCL14 ccl14 (Catalog #AAA1275415) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagatct ccgtggctgc cattcccttc ttcctcctca tcaccatcgc cctagggacc aagactgaat cctcctcacg gggaccttac cacccctcag agtgctgctt cacctacact acctacaaga tcccgcgtca gcggattatg gattactatg agaccaacag ccagtgctcc aagcccggaa ttgtcttcat caccaaaagg ggccattccg tctgtaccaa ccccagtgac aagtgggtcc aggactatat caaggacatg aaggagaact ga. It is sometimes possible for the material contained within the vial of "CCL14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.