Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TTC35 cdna clone

TTC35 cDNA Clone

Gene Names
EMC2; TTC35; KIAA0103
Synonyms
TTC35; TTC35 cDNA Clone; TTC35 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgaaggtctcagagctttacgatgtcacttgggaagaaatgagagataaaatgagaaaatggagagaagaaaactcaagaaatagtgagcaaattgtggaagttggagaagaattaattaatgaatatgcttctaagctgggagatgatatttggatcatatatgaacaggtgatgattgcagcactagactatggtcgggatgacttggcattgttttgtcttcaagagctgagaagacagttccctggcagtcacagagtcaagcgattaacaggcatgagatttgaagccatggaaagatatgatgatgctatacagctatatgataggattttacaagaagatccaactaacactgctgcaagaaagcgtaagattgccattcgaaaagcccaggggaaaaatgtggaggccattcgggagctgagtgagtatctggaacaatttgttggagaccaagaagcctggcatgaacttgcagaactttacatcaatgaacatgactatgcaaaagcagccttttgtttagaggaactaatgatgactaatccacacaaccacttatactgtcagcagtatgctgaagttaagtatacccaaggtggacttgaaaacctcgaactttcaagaaagtattttgcacaggcattgaaactgaacaacagaaatatgagagctttgtttggactttatatgtcggcaagtcatattgcttctaatccaaaagcaagtgcaaaaacgaaaaaggacaacatgaaatatgctagttgggcagctagtcaaataaacagagcttatcagtttgcaggtcgaagtaagaaggaaaccaaatattctcttaaggctgtcgaagacatgttggaaacattgcagatcacccagtcttaa
Sequence Length
894
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,834 Da
NCBI Official Full Name
Homo sapiens tetratricopeptide repeat domain 35, mRNA
NCBI Official Synonym Full Names
ER membrane protein complex subunit 2
NCBI Official Symbol
EMC2
NCBI Official Synonym Symbols
TTC35; KIAA0103
NCBI Protein Information
ER membrane protein complex subunit 2
UniProt Protein Name
ER membrane protein complex subunit 2
UniProt Gene Name
EMC2
UniProt Synonym Gene Names
KIAA0103; TTC35; TPR repeat protein 35
UniProt Entry Name
EMC2_HUMAN

Uniprot Description

TTC35: Belongs to the EMC2 family.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 8q23.1

Cellular Component: cytoplasm; endoplasmic reticulum

Molecular Function: protein binding

Research Articles on TTC35

Similar Products

Product Notes

The TTC35 emc2 (Catalog #AAA1275353) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgaagg tctcagagct ttacgatgtc acttgggaag aaatgagaga taaaatgaga aaatggagag aagaaaactc aagaaatagt gagcaaattg tggaagttgg agaagaatta attaatgaat atgcttctaa gctgggagat gatatttgga tcatatatga acaggtgatg attgcagcac tagactatgg tcgggatgac ttggcattgt tttgtcttca agagctgaga agacagttcc ctggcagtca cagagtcaag cgattaacag gcatgagatt tgaagccatg gaaagatatg atgatgctat acagctatat gataggattt tacaagaaga tccaactaac actgctgcaa gaaagcgtaa gattgccatt cgaaaagccc aggggaaaaa tgtggaggcc attcgggagc tgagtgagta tctggaacaa tttgttggag accaagaagc ctggcatgaa cttgcagaac tttacatcaa tgaacatgac tatgcaaaag cagccttttg tttagaggaa ctaatgatga ctaatccaca caaccactta tactgtcagc agtatgctga agttaagtat acccaaggtg gacttgaaaa cctcgaactt tcaagaaagt attttgcaca ggcattgaaa ctgaacaaca gaaatatgag agctttgttt ggactttata tgtcggcaag tcatattgct tctaatccaa aagcaagtgc aaaaacgaaa aaggacaaca tgaaatatgc tagttgggca gctagtcaaa taaacagagc ttatcagttt gcaggtcgaa gtaagaagga aaccaaatat tctcttaagg ctgtcgaaga catgttggaa acattgcaga tcacccagtc ttaa. It is sometimes possible for the material contained within the vial of "TTC35, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.