TTC23 cdna clone
TTC23 cDNA Clone
Gene Names
TTC23; HCC-8
Synonyms
TTC23; TTC23 cDNA Clone; TTC23 cdna clone
Sequence
atgcaagaatcacaggaaacccacatatccaaccacctagatgaagttgttgctgctgttagcatcactcatagaaagaagttccaaaacaagctgcttcagacagcactattccagcctcctcgagagaaactccacctctgtgaagagaaagcaaagtcctattccaacagtcatgagtacaaacaggccgtccatgagcttgtgcgttgcgtagcactgacaagaatttgctatggagactcacattggaaactagcagaggcacatgttaatctggctcaaggctacctccagctgaaaggactgtcactgcaagcaaaacaacatgcagaaaaagccagacaaatcctcgccaactccattgtgcctccctatagtgagaatacagatgttttcaagttttccattgagcttttccataccatgggcagagctttactctcccttcaaaaatttaaggaagctgcagagaatttgacaaaagcagagagactttcaaaggagctgctacaatgtggaagaattataaaggaagaatggatagaaattgaagcacggatcagattatcatttgcacaggtgtatcaaggtcagaagaagtcaaaagaagctttgtcccactatcaagcagctttggaatatgttgagatcagtaaaggtgaaacaagtcgtgagtgtgtacccatattgagagaattagcaggtgtagagcaagccctgggactccacgatgtatccatcaaccacttcctccaggcacatctcatcatcctgagtagaagcccctctcaagtggaggcagcagactcggcacacatcgtcgcccatgctgctgtcgcttcagggagacacgagcaccatgatgtagctgagcagtattttcaagagagcatggctcatcttaaggattctgaagggatgggaagaaccaaatttctttcaattcaagatgaattttgccattttctacaaatgactggacaaaaagagagagcaacctcgatcctgagagagtccctggaagccaaagtggaagcatttggcgatttcagtcccgaggtggcagagacataccggctcctgggaggagcagacctggcgcaggggaaccacagtggggcccgcaagaaactgaagaagggagaccttagtttcctgctctcagcgacacttccatag
Sequence Length
1182
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
44,238 Da
NCBI Official Full Name
Homo sapiens tetratricopeptide repeat domain 23, mRNA
NCBI Official Synonym Full Names
tetratricopeptide repeat domain 23
NCBI Official Symbol
TTC23
NCBI Official Synonym Symbols
HCC-8
NCBI Protein Information
tetratricopeptide repeat protein 23
UniProt Protein Name
Tetratricopeptide repeat protein 23
Protein Family
UniProt Gene Name
TTC23
UniProt Synonym Gene Names
TPR repeat protein 23; HCC-8
UniProt Entry Name
TTC23_HUMAN
Uniprot Description
TTC23: 3 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 15q26.3
Molecular Function: protein binding
Research Articles on TTC23
Similar Products
Product Notes
The TTC23 ttc23 (Catalog #AAA1274916) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaagaat cacaggaaac ccacatatcc aaccacctag atgaagttgt tgctgctgtt agcatcactc atagaaagaa gttccaaaac aagctgcttc agacagcact attccagcct cctcgagaga aactccacct ctgtgaagag aaagcaaagt cctattccaa cagtcatgag tacaaacagg ccgtccatga gcttgtgcgt tgcgtagcac tgacaagaat ttgctatgga gactcacatt ggaaactagc agaggcacat gttaatctgg ctcaaggcta cctccagctg aaaggactgt cactgcaagc aaaacaacat gcagaaaaag ccagacaaat cctcgccaac tccattgtgc ctccctatag tgagaataca gatgttttca agttttccat tgagcttttc cataccatgg gcagagcttt actctccctt caaaaattta aggaagctgc agagaatttg acaaaagcag agagactttc aaaggagctg ctacaatgtg gaagaattat aaaggaagaa tggatagaaa ttgaagcacg gatcagatta tcatttgcac aggtgtatca aggtcagaag aagtcaaaag aagctttgtc ccactatcaa gcagctttgg aatatgttga gatcagtaaa ggtgaaacaa gtcgtgagtg tgtacccata ttgagagaat tagcaggtgt agagcaagcc ctgggactcc acgatgtatc catcaaccac ttcctccagg cacatctcat catcctgagt agaagcccct ctcaagtgga ggcagcagac tcggcacaca tcgtcgccca tgctgctgtc gcttcaggga gacacgagca ccatgatgta gctgagcagt attttcaaga gagcatggct catcttaagg attctgaagg gatgggaaga accaaatttc tttcaattca agatgaattt tgccattttc tacaaatgac tggacaaaaa gagagagcaa cctcgatcct gagagagtcc ctggaagcca aagtggaagc atttggcgat ttcagtcccg aggtggcaga gacataccgg ctcctgggag gagcagacct ggcgcagggg aaccacagtg gggcccgcaa gaaactgaag aagggagacc ttagtttcct gctctcagcg acacttccat ag. It is sometimes possible for the material contained within the vial of "TTC23, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
