Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAPGEF5 cdna clone

RAPGEF5 cDNA Clone

Gene Names
RAPGEF5; GFR; REPAC; MR-GEF
Synonyms
RAPGEF5; RAPGEF5 cDNA Clone; RAPGEF5 cdna clone
Ordering
For Research Use Only!
Sequence
atgggcagctcccggctgagggtctttgaccctcatttggagaggaaagattccgccgcggcgctctcagaccgagagctgcccttgcctaccttcgatgtgccttatttcaaatacatcgacgaggaggatgaggacgatgaatggagcagccgctcgcagtcttccaccgaggatgactcagtggactctctgctctctgacagatatgtggtggtgtccgggaccccggagaagattttggagcaccttttgaatgacttgcacctggaagaagtccaggacaaagaaacagagaccctcctggatgacttccttctcacgtacactgtcttcatgacaactgatgacttgtgccaggctctgttaaggcactattctgctaagaagtatcaaggcaaagaggaaaactcagatgttccgcgtaggaaacgtaaagtcttgcatcttgtttcccagtggattgctctgtacaaagactggttacctgaagatgaacattcaaaaatgtttttaaagaccatatataggaatgtactggatgatgtttatgaatatccaatacttgaaaaagaattgaaagaatttcaaaagatacttggaatgcaccgtcgtcacactgtagatgaatattcaccacaaaaaaagaataaagcccttttccaccaattcagtcttaaggagaactggctccagcatagaggaactgtgactgaaacggaggaaattttctgccacgtgtatataacagagcactcctatgtcagtgtgaaggcaaaagtttccagtatagcccaagagattctgctctgcagccagctgggcaagcgagtgcagctggtgaaaaaattcatcaaaattgcggctcactgcaaagcccagagaaacctgaattctttctttgccattgtgatgggtctcaacactgcttctgtcagtcgactgtcgcagacctgggagaaaatccctgggaagtttaagaaacttttctctgaacttgaaagtttaacagatccttccctaaatcacaaagcctacagagatgcattcaaaaagatgaagccaccaaaaatccctttcgtgcccttattgcttaaagatgtaacatttattcatgaaggaaataaaacttttttggataatcttgtcaattttgaaaagctgcatatgatcgcagacactgtccgaaccctgagacactgcaggactaaccagtttggtgacctgtctccaaaagagcatcaagagttaaagtcctatgttaatcacctgtatgtcattgacagccagcaggctctgtttgagctctcacacaggatcgagcctcgggtgtga
Sequence Length
1335
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,083 Da
NCBI Official Full Name
Homo sapiens Rap guanine nucleotide exchange factor (GEF) 5, mRNA
NCBI Official Synonym Full Names
Rap guanine nucleotide exchange factor 5
NCBI Official Symbol
RAPGEF5
NCBI Official Synonym Symbols
GFR; REPAC; MR-GEF
NCBI Protein Information
rap guanine nucleotide exchange factor 5
UniProt Protein Name
Rap guanine nucleotide exchange factor 5
UniProt Gene Name
RAPGEF5
UniProt Synonym Gene Names
GFR; KIAA0277; MRGEF; MR-GEF; Repac
UniProt Entry Name
RPGF5_HUMAN

NCBI Description

Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RAPGEF5, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]

Uniprot Description

RAPGEF5: Guanine nucleotide exchange factor (GEF) for RAP1A, RAP2A and MRAS/M-Ras-GTP. Its association with MRAS inhibits Rap1 activation. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: GAPs, Ras; GAPs

Chromosomal Location of Human Ortholog: 7p15.3

Cellular Component: nucleus

Molecular Function: GTP-dependent protein binding; Rap guanyl-nucleotide exchange factor activity; Ras guanyl-nucleotide exchange factor activity

Research Articles on RAPGEF5

Similar Products

Product Notes

The RAPGEF5 rapgef5 (Catalog #AAA1274344) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcagct cccggctgag ggtctttgac cctcatttgg agaggaaaga ttccgccgcg gcgctctcag accgagagct gcccttgcct accttcgatg tgccttattt caaatacatc gacgaggagg atgaggacga tgaatggagc agccgctcgc agtcttccac cgaggatgac tcagtggact ctctgctctc tgacagatat gtggtggtgt ccgggacccc ggagaagatt ttggagcacc ttttgaatga cttgcacctg gaagaagtcc aggacaaaga aacagagacc ctcctggatg acttccttct cacgtacact gtcttcatga caactgatga cttgtgccag gctctgttaa ggcactattc tgctaagaag tatcaaggca aagaggaaaa ctcagatgtt ccgcgtagga aacgtaaagt cttgcatctt gtttcccagt ggattgctct gtacaaagac tggttacctg aagatgaaca ttcaaaaatg tttttaaaga ccatatatag gaatgtactg gatgatgttt atgaatatcc aatacttgaa aaagaattga aagaatttca aaagatactt ggaatgcacc gtcgtcacac tgtagatgaa tattcaccac aaaaaaagaa taaagccctt ttccaccaat tcagtcttaa ggagaactgg ctccagcata gaggaactgt gactgaaacg gaggaaattt tctgccacgt gtatataaca gagcactcct atgtcagtgt gaaggcaaaa gtttccagta tagcccaaga gattctgctc tgcagccagc tgggcaagcg agtgcagctg gtgaaaaaat tcatcaaaat tgcggctcac tgcaaagccc agagaaacct gaattctttc tttgccattg tgatgggtct caacactgct tctgtcagtc gactgtcgca gacctgggag aaaatccctg ggaagtttaa gaaacttttc tctgaacttg aaagtttaac agatccttcc ctaaatcaca aagcctacag agatgcattc aaaaagatga agccaccaaa aatccctttc gtgcccttat tgcttaaaga tgtaacattt attcatgaag gaaataaaac ttttttggat aatcttgtca attttgaaaa gctgcatatg atcgcagaca ctgtccgaac cctgagacac tgcaggacta accagtttgg tgacctgtct ccaaaagagc atcaagagtt aaagtcctat gttaatcacc tgtatgtcat tgacagccag caggctctgt ttgagctctc acacaggatc gagcctcggg tgtga. It is sometimes possible for the material contained within the vial of "RAPGEF5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.