Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCNG2 cdna clone

CCNG2 cDNA Clone

Synonyms
CCNG2; CCNG2 cDNA Clone; CCNG2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaggatttgggggcagagcacttggcaggtcatgaaggggtccaacttctcgggttgttgaacgtctacctggaacaagaagagagattccaacctcgagaaaaagggctgagtttgattgaggctaccccggagaatgataacactttgtgtccaggattgagaaatgccaaagttgaagatttaaggagtttagccaacttttttggatcttgcactgaaacttttgtcctggctgtcaatattttggacaggttcttggctcttatgaaggtgaaacctaaacatttgtcttgcattggagtctgttcttttttgctggctgctagaatagttgaagaagactgcaatattccatccactcatgatgtgatccggattagtcagtgtaaatgtactgcttctgacataaaacggatggaaaaaataatttcagaaaaattgcactatgaattggaagctactactgccttaaactttttgcacttataccatactattatactttgtcatacttcagaaaggaaagaaatactgagccttgataaactagaagctcagctgaaagcttgcaactgccgactcatcttttcaaaagcaaaaccatctgtattagccttgtgccttctcaatttggaagtggaaactttgaaatctgttgaattactggaaattctcttgctagttaaaaaacattccaagattaatgacactgagttcttctactggagagagttggtttctaaatgcctagccgagtattcttctcctgaatgttgcaaaccagatcttaagaagttggtttggatcgtttcaaggcgcacagcccagaacctccacaacagctactatagtgttcctgagctgccaacgatacctgaggggggttgttttgatgaaagtgaaagctctgttgcccaggctggagtgcagtggcccgatctcagctcattccaacctccacctaccaggttcaagcgattctcatgcctcagcctccggagtagctgggattacagctcctggacctga
Sequence Length
1035
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
901
Molecular Weight
34,522 Da
NCBI Official Full Name
Homo sapiens cyclin G2, mRNA
NCBI Official Synonym Full Names
cyclin G2
NCBI Official Symbol
CCNG2
NCBI Protein Information
cyclin-G2
UniProt Protein Name
Cyclin-G2
Protein Family
UniProt Gene Name
CCNG2
UniProt Entry Name
CCNG2_HUMAN

NCBI Description

The eukaryotic cell cycle is governed by cyclin-dependent protein kinases (CDKs) whose activities are regulated by cyclins and CDK inhibitors. The 8 species of cyclins reported in mammals, cyclins A through H, share a conserved amino acid sequence of about 90 residues called the cyclin box. The amino acid sequence of cyclin G is well conserved among mammals. The nucleotide sequence of cyclin G1 and cyclin G2 are 53% identical. Unlike cyclin G1, cyclin G2 contains a C-terminal PEST protein destabilization motif, suggesting that cyclin G2 expression is tightly regulated through the cell cycle. [provided by RefSeq, Jul 2008]

Uniprot Description

CCNG2: May play a role in growth regulation and in negative regulation of cell cycle progession. Belongs to the cyclin family. Cyclin G subfamily.

Protein type: Cell cycle regulation

Chromosomal Location of Human Ortholog: 4q21.1

Biological Process: cell cycle checkpoint

Research Articles on CCNG2

Similar Products

Product Notes

The CCNG2 ccng2 (Catalog #AAA1274294) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggatt tgggggcaga gcacttggca ggtcatgaag gggtccaact tctcgggttg ttgaacgtct acctggaaca agaagagaga ttccaacctc gagaaaaagg gctgagtttg attgaggcta ccccggagaa tgataacact ttgtgtccag gattgagaaa tgccaaagtt gaagatttaa ggagtttagc caactttttt ggatcttgca ctgaaacttt tgtcctggct gtcaatattt tggacaggtt cttggctctt atgaaggtga aacctaaaca tttgtcttgc attggagtct gttctttttt gctggctgct agaatagttg aagaagactg caatattcca tccactcatg atgtgatccg gattagtcag tgtaaatgta ctgcttctga cataaaacgg atggaaaaaa taatttcaga aaaattgcac tatgaattgg aagctactac tgccttaaac tttttgcact tataccatac tattatactt tgtcatactt cagaaaggaa agaaatactg agccttgata aactagaagc tcagctgaaa gcttgcaact gccgactcat cttttcaaaa gcaaaaccat ctgtattagc cttgtgcctt ctcaatttgg aagtggaaac tttgaaatct gttgaattac tggaaattct cttgctagtt aaaaaacatt ccaagattaa tgacactgag ttcttctact ggagagagtt ggtttctaaa tgcctagccg agtattcttc tcctgaatgt tgcaaaccag atcttaagaa gttggtttgg atcgtttcaa ggcgcacagc ccagaacctc cacaacagct actatagtgt tcctgagctg ccaacgatac ctgagggggg ttgttttgat gaaagtgaaa gctctgttgc ccaggctgga gtgcagtggc ccgatctcag ctcattccaa cctccaccta ccaggttcaa gcgattctca tgcctcagcc tccggagtag ctgggattac agctcctgga cctga. It is sometimes possible for the material contained within the vial of "CCNG2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.