Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RBCK1 cdna clone

RBCK1 cDNA Clone

Gene Names
RBCK1; XAP3; XAP4; HOIL1; PBMEI; PGBM1; RBCK2; RNF54; HOIL-1; ZRANB4; C20orf18; UBCE7IP3
Synonyms
RBCK1; RBCK1 cDNA Clone; RBCK1 cdna clone
Ordering
For Research Use Only!
Sequence
atggccctgagcctcacccgagcagtggcgggcggggatgaacaggtggcaatgaagtgtgccatctggctggcagagcaacgggtgcccctgagtgtgcaactgaagcctgaggtctccccaacgcaggacatcaggctgtgggtgagcgtggaggatgctcagatgcacaccgtcaccatctggctcacagtgcgccctgatatgacagtggcgtctctcaaggacatggtttttctggactatggcttcccaccagtcttgcagcagtgggtgattgggcagcggctggcacgagaccaggagaccctgcactcccatggggtgcggcagaatggggacagtgcctacctctatctgctgtcagcccgcaacacctccctcaaccctcaggagctgcagcgggagcggcagctgcggatgctggaagatctgggcttcaaggacctcacgctgcagccgcggggccctctggagccaggccccccaaagcccggggtcccccaggaacccggacgggggcagccagatgcagtgcctgagcccccaccggtgggctggcagtgccccgggtgcaccttcatcaacaagcccacgcggcctggctgtgagatgtgctgccgggcgcgccccgaggcctaccaggtccccgcctcataccagcccgacgaggaggagcgagcgcgcctggcgggcgaggaggaggcgctgcgtcagtaccagcagcggaagcagcagcagcaggaggggaactacctgcagcacgtccagctggaccagaggagcctggtgctgaacacggagcccgccgagtgccccgtgtgctactcggtgctggcgcccggcgaggccgtggtgctgcgtgagtgtctgcacaccttctgcagggagtgcctgcagggcaccatccgcaacagccaggaggcggaggtctcctgccccttcattgacaacacctactcgtgctcgggcaagctgctggagagggagatcaaggcgctcctgacccctgaggattaccagcgatttctagacctgggcatctccattgctgaaaaccgcagtgccttcagctaccattgcaagaccccagattgcaagggatggtgcttctttgaggatgatgtcaatgagttcacctgccctgtgtgtttccacgtcaactgcctgctctgcaaggccatccatgagcagatgaactgcaaggagtatcaggaggacctggccctgcgggctcagaacgatgtggctgcccggcagacgacagagatgctgaaggtgatgctgcagcagggcgaggccatgcgctgcccccagtgccagatcgtggtacagaagaaggacggctgcgactggatccgctgcaccgtctgccacaccgagatctgctgggtcaccaagggcccacgctggggccctgggggcccaggagacaccagcgggggctgccgctgcagggtaaatgggattccttgccacccaagctgtcagaactgccactga
Sequence Length
1503
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,654 Da
NCBI Official Full Name
Homo sapiens RanBP-type and C3HC4-type zinc finger containing 1, mRNA
NCBI Official Synonym Full Names
RANBP2-type and C3HC4-type zinc finger containing 1
NCBI Official Symbol
RBCK1
NCBI Official Synonym Symbols
XAP3; XAP4; HOIL1; PBMEI; PGBM1; RBCK2; RNF54; HOIL-1; ZRANB4; C20orf18; UBCE7IP3
NCBI Protein Information
ranBP-type and C3HC4-type zinc finger-containing protein 1
UniProt Protein Name
RanBP-type and C3HC4-type zinc finger-containing protein 1
UniProt Gene Name
RBCK1
UniProt Synonym Gene Names
C20orf18; RNF54; UBCE7IP3; XAP3; XAP4; HOIL-1
UniProt Entry Name
HOIL1_HUMAN

NCBI Description

The protein encoded by this gene is similar to mouse UIP28/UbcM4 interacting protein. Alternative splicing has been observed at this locus, resulting in distinct isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

RBCK1: a E3 ubiquitin-protein ligase that contains a zf-RanBP (Zn-finger in Ran binding protein) and a zf-C3HC4 (RING finger) domain. Phosphorylation apparently reduces its E3 activity. Functions as a transcriptional activator. Its nuclear translocation is prevented by binding to a splice-variant of RBCK1 that lacks the RING finger domain. Interacts with PKCB1, PKCZ, and accepts ubiquitin from E2 ubiquitin-conjugating enzymes including UBE2L3. Interacts with PKCH. Interacts with the HBV pX/HBx protein, which is required to activate transcription of the viral genome. Three splice-variant isoforms of the human protein have been reported.

Protein type: Ligase; Ubiquitin ligase; EC 6.3.2.-; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 20p13

Cellular Component: cytosol

Molecular Function: protein binding; ubiquitin binding; ubiquitin-protein ligase activity

Biological Process: activation of NF-kappaB transcription factor; I-kappaB kinase/NF-kappaB cascade; inhibition of NF-kappaB transcription factor; positive regulation of I-kappaB kinase/NF-kappaB cascade; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; T cell receptor signaling pathway

Disease: Polyglucosan Body Myopathy, Early-onset, With Or Without Immunodeficiency

Research Articles on RBCK1

Similar Products

Product Notes

The RBCK1 rbck1 (Catalog #AAA1273795) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccctga gcctcacccg agcagtggcg ggcggggatg aacaggtggc aatgaagtgt gccatctggc tggcagagca acgggtgccc ctgagtgtgc aactgaagcc tgaggtctcc ccaacgcagg acatcaggct gtgggtgagc gtggaggatg ctcagatgca caccgtcacc atctggctca cagtgcgccc tgatatgaca gtggcgtctc tcaaggacat ggtttttctg gactatggct tcccaccagt cttgcagcag tgggtgattg ggcagcggct ggcacgagac caggagaccc tgcactccca tggggtgcgg cagaatgggg acagtgccta cctctatctg ctgtcagccc gcaacacctc cctcaaccct caggagctgc agcgggagcg gcagctgcgg atgctggaag atctgggctt caaggacctc acgctgcagc cgcggggccc tctggagcca ggccccccaa agcccggggt cccccaggaa cccggacggg ggcagccaga tgcagtgcct gagcccccac cggtgggctg gcagtgcccc gggtgcacct tcatcaacaa gcccacgcgg cctggctgtg agatgtgctg ccgggcgcgc cccgaggcct accaggtccc cgcctcatac cagcccgacg aggaggagcg agcgcgcctg gcgggcgagg aggaggcgct gcgtcagtac cagcagcgga agcagcagca gcaggagggg aactacctgc agcacgtcca gctggaccag aggagcctgg tgctgaacac ggagcccgcc gagtgccccg tgtgctactc ggtgctggcg cccggcgagg ccgtggtgct gcgtgagtgt ctgcacacct tctgcaggga gtgcctgcag ggcaccatcc gcaacagcca ggaggcggag gtctcctgcc ccttcattga caacacctac tcgtgctcgg gcaagctgct ggagagggag atcaaggcgc tcctgacccc tgaggattac cagcgatttc tagacctggg catctccatt gctgaaaacc gcagtgcctt cagctaccat tgcaagaccc cagattgcaa gggatggtgc ttctttgagg atgatgtcaa tgagttcacc tgccctgtgt gtttccacgt caactgcctg ctctgcaagg ccatccatga gcagatgaac tgcaaggagt atcaggagga cctggccctg cgggctcaga acgatgtggc tgcccggcag acgacagaga tgctgaaggt gatgctgcag cagggcgagg ccatgcgctg cccccagtgc cagatcgtgg tacagaagaa ggacggctgc gactggatcc gctgcaccgt ctgccacacc gagatctgct gggtcaccaa gggcccacgc tggggccctg ggggcccagg agacaccagc gggggctgcc gctgcagggt aaatgggatt ccttgccacc caagctgtca gaactgccac tga. It is sometimes possible for the material contained within the vial of "RBCK1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.