Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DIAPH3 cdna clone

DIAPH3 cDNA Clone

Gene Names
DIAPH3; AN; DIA2; DRF3; AUNA1; NSDAN; diap3; mDia2
Synonyms
DIAPH3; DIAPH3 cDNA Clone; DIAPH3 cdna clone
Ordering
For Research Use Only!
Sequence
atgagtgaggagaggagcctttccttattggccaaagccgtggatcccagacaccccaatatgatgacagatgtggttaaacttctctctgcggtatgcattgtaggggaagaaagcatccttgaagaagttttagaagctttaacttcagctggtgaagaaaaaaaaattgacagatttttttgtattgtggaaggcctccggcacaattcagttcaactgcaagtagcttgtatgcagctcatcaatgccctggttacatctcctgatgatttggatttcaggcttcacatcagaaatgaatttatgcgttgtggattgaaagagatattgccaaatttaaaatgcattaagaatgatggcctggatatccaacttaaagtctttgatgagcataaagaagaagatttgtttgagttatcccatcgccttgaagatattagagctgaacttgatgaagcatatgatgtttacaacatggtgtggagcacagttaaagaaactagagcagagggatattttatttctattcttcagcatcttttgctgattcgaaatgattattttataaggcaacaatacttcaaattaattgatgagtgtgtatcccagattgtattgcatagagatggaatggatccagacttcacatatcgaaaaagactagatttagatttaacccagtttgtagacatttgcatagatcaagcaaaactagaagagtttgaagagaaagcatcagaactttacaagaaatttgaaaaagagtttaccgaccaccaagaaactcaggctgaattgcagaaaaaagaggcaaagattaatgagcttcaagcagagctacaagcttttaagtctcagtttggtgccttgccagctgattgtaatattcctttgcctccctctaaagaaggtggaactggccactcagcacttcctcctccgcctccactgccttctggtggaggggtgccgcctccacctcctcccccaccacctcctccacttccaggaatgcggatgccattcagtggtcctgtgcctccaccacctcccctgggattccttggaggacaaaattctcctcctctaccaatcctgccatttgggttgaaaccaaagaaagaatttaaacctgaaatcagcatgagaagattgaattggttaaagatcagacctcatgaaatgactgaaaactgtttctggataaaagtaaatgaaaataagtatgaaaacgtggatttgctttgtaaacttgagaatacattttgttgccaacaaaaagagagaagagaagaggaagatattgaagagaagaaatcgattaagaaaaaaattaaagaacttaagtttttagattctaaaattgcccagaacctttcaatcttcctgagctcttttcgggtgccatatgaggaaatcagaatgatgatattggaagtagatgaaacacggttggcagagtctatgattcagaacttaataaagcatcttcctgatcaagagcaattaaattcattgtctcagttcaagagtgaatatagcaacttatgtgaacctgagcagtttgtggttgtgatgagcaatgtgaagagactacggccacggctcagtgctattctctttaagcttcagtttgaagagcaggtgaacaacatcaaacctgacatcatggctgtcagtactgcctgcgaagagataaagaagagcaaaagctttagcaagttgctggaacttgtattgctaatgggaaactacatgaatgctggctcccggaatgctcaaaccttcggatttaaccttagctctctctgtaaactaaaggacacaaaatcagcagatcagaaaacaacgctacttcatttcctggtagaaatatgtgaagagaagtaccctgatatactgaattttgtggatgatttggaacctttagacaaagctagtaaagtctctgtagaaacgctggaaaagaatttgaggcagatgggaaggcagcttcaacagcttgagaaggaattggaaacctttccccctcctgaggacttgcatgacaagtttgtgacaaagatgtccagatttgttatcagtgcaaaagaacaatatgagacactttcgaagttacacgaaaacatggaaaagttataccagagtataataggatactatgccattgatgtgaagaaggtgtctgtggaagactttcttactgacctgaataacttcagaaccacattcatgcaagcaataaaggagaatatcaaaaaaagagaagcagaggaaaaagaaaaacgtgtcagaatagctaaagaattagcagagcgagaaagactcgaacgccaacaaaagaaaaagcgtttattagaaatgaagactgagggtgatgagacaggagtgatggataatctgctggaggccttgcagtccggggctgccttccgcgacagaagaaaaaggacaccgatgccaaaagatgttcggcagagtctcagtccaatgtctcagaggcctgttctgaaagtttgtaaccatggtaataaaccgtatttataa
Sequence Length
2550
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
127,856 Da
NCBI Official Full Name
Homo sapiens diaphanous homolog 3 (Drosophila), mRNA
NCBI Official Synonym Full Names
diaphanous related formin 3
NCBI Official Symbol
DIAPH3
NCBI Official Synonym Symbols
AN; DIA2; DRF3; AUNA1; NSDAN; diap3; mDia2
NCBI Protein Information
protein diaphanous homolog 3
UniProt Protein Name
Protein diaphanous homolog 3
Protein Family
UniProt Gene Name
DIAPH3
UniProt Synonym Gene Names
DIAP3; DRF3
UniProt Entry Name
DIAP3_HUMAN

NCBI Description

This gene encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in this gene are associated with autosomal dominant auditory neuropathy 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

Uniprot Description

Diaphanous-3: Binds to GTP-bound form of Rho and to profilin. Acts in a Rho-dependent manner to recruit profilin to the membrane, where it promotes actin polymerization. It is required for cytokinesis, stress fiber formation, and transcriptional activation of the serum response factor. DFR proteins couple Rho and Src tyrosine kinase during signaling and the regulation of actin dynamics. Defects in DIAPH3 are the cause of auditory neuropathy, autosomal dominant, type 1 (AUNA1). A form of sensorineural hearing loss with absent or severely abnormal auditory brainstem response, in the presence of normal cochlear outer hair cell function and normal otoacoustic emissions. Auditory neuropathies result from a lesion in the area including the inner hair cells, connections between the inner hair cells and the cochlear branch of the auditory nerve, the auditory nerve itself and auditory pathways of the brainstem. A disease- causing mutation in the conserved 5'-UTR leads to increased protein expression (PubMed:20624953). Belongs to the formin homology family. Diaphanous subfamily. 7 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 13q21.2

Cellular Component: cell-cell adherens junction; cytosol

Disease: Auditory Neuropathy, Autosomal Dominant, 1

Research Articles on DIAPH3

Similar Products

Product Notes

The DIAPH3 diaph3 (Catalog #AAA1272865) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtgagg agaggagcct ttccttattg gccaaagccg tggatcccag acaccccaat atgatgacag atgtggttaa acttctctct gcggtatgca ttgtagggga agaaagcatc cttgaagaag ttttagaagc tttaacttca gctggtgaag aaaaaaaaat tgacagattt ttttgtattg tggaaggcct ccggcacaat tcagttcaac tgcaagtagc ttgtatgcag ctcatcaatg ccctggttac atctcctgat gatttggatt tcaggcttca catcagaaat gaatttatgc gttgtggatt gaaagagata ttgccaaatt taaaatgcat taagaatgat ggcctggata tccaacttaa agtctttgat gagcataaag aagaagattt gtttgagtta tcccatcgcc ttgaagatat tagagctgaa cttgatgaag catatgatgt ttacaacatg gtgtggagca cagttaaaga aactagagca gagggatatt ttatttctat tcttcagcat cttttgctga ttcgaaatga ttattttata aggcaacaat acttcaaatt aattgatgag tgtgtatccc agattgtatt gcatagagat ggaatggatc cagacttcac atatcgaaaa agactagatt tagatttaac ccagtttgta gacatttgca tagatcaagc aaaactagaa gagtttgaag agaaagcatc agaactttac aagaaatttg aaaaagagtt taccgaccac caagaaactc aggctgaatt gcagaaaaaa gaggcaaaga ttaatgagct tcaagcagag ctacaagctt ttaagtctca gtttggtgcc ttgccagctg attgtaatat tcctttgcct ccctctaaag aaggtggaac tggccactca gcacttcctc ctccgcctcc actgccttct ggtggagggg tgccgcctcc acctcctccc ccaccacctc ctccacttcc aggaatgcgg atgccattca gtggtcctgt gcctccacca cctcccctgg gattccttgg aggacaaaat tctcctcctc taccaatcct gccatttggg ttgaaaccaa agaaagaatt taaacctgaa atcagcatga gaagattgaa ttggttaaag atcagacctc atgaaatgac tgaaaactgt ttctggataa aagtaaatga aaataagtat gaaaacgtgg atttgctttg taaacttgag aatacatttt gttgccaaca aaaagagaga agagaagagg aagatattga agagaagaaa tcgattaaga aaaaaattaa agaacttaag tttttagatt ctaaaattgc ccagaacctt tcaatcttcc tgagctcttt tcgggtgcca tatgaggaaa tcagaatgat gatattggaa gtagatgaaa cacggttggc agagtctatg attcagaact taataaagca tcttcctgat caagagcaat taaattcatt gtctcagttc aagagtgaat atagcaactt atgtgaacct gagcagtttg tggttgtgat gagcaatgtg aagagactac ggccacggct cagtgctatt ctctttaagc ttcagtttga agagcaggtg aacaacatca aacctgacat catggctgtc agtactgcct gcgaagagat aaagaagagc aaaagcttta gcaagttgct ggaacttgta ttgctaatgg gaaactacat gaatgctggc tcccggaatg ctcaaacctt cggatttaac cttagctctc tctgtaaact aaaggacaca aaatcagcag atcagaaaac aacgctactt catttcctgg tagaaatatg tgaagagaag taccctgata tactgaattt tgtggatgat ttggaacctt tagacaaagc tagtaaagtc tctgtagaaa cgctggaaaa gaatttgagg cagatgggaa ggcagcttca acagcttgag aaggaattgg aaacctttcc ccctcctgag gacttgcatg acaagtttgt gacaaagatg tccagatttg ttatcagtgc aaaagaacaa tatgagacac tttcgaagtt acacgaaaac atggaaaagt tataccagag tataatagga tactatgcca ttgatgtgaa gaaggtgtct gtggaagact ttcttactga cctgaataac ttcagaacca cattcatgca agcaataaag gagaatatca aaaaaagaga agcagaggaa aaagaaaaac gtgtcagaat agctaaagaa ttagcagagc gagaaagact cgaacgccaa caaaagaaaa agcgtttatt agaaatgaag actgagggtg atgagacagg agtgatggat aatctgctgg aggccttgca gtccggggct gccttccgcg acagaagaaa aaggacaccg atgccaaaag atgttcggca gagtctcagt ccaatgtctc agaggcctgt tctgaaagtt tgtaaccatg gtaataaacc gtatttataa. It is sometimes possible for the material contained within the vial of "DIAPH3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.