DAK cdna clone
DAK cDNA Clone
Gene Names
TKFC; DAK; NET45
Synonyms
DAK; DAK cDNA Clone; DAK cdna clone
Sequence
atgacctccaagaagctggtgaactcggtggctggctgtgctgatgacgctcttgctggcctggtggcctgcaaccccaacctgcagctcctgcagggccaccgcgtggccctccgttctgacctggacagcctcaagggccgggtggcactgctgtcgggtgggggctctggccatgagcctgcccatgctggtttcatagggaaggggatgctgactggggtcatcgcgggagctgtgttcacctccccggcagtgggcagcatcctggcagccatcagggccgtggcccaggccggcacagtggggacgctccttatcgtgaagaactacactggggatcggctcaacttcggcctggcccgggagcaggcccgggctgaaggcatcccggtggagatggtggtgattggggacgacagcgccttcactgtcctgaagaaggcaggccggcgggggctgtgcggcacggtgcttatacacaaggtggcaggtgctctggctgaggctggtgtggggctggaggagatcgcaaagcaggtgaacgtggtcgccaaggccatgggtaccctgggggtgagcttatcctcctgcagcgtccctggttccaaacccaccttcgagctctcagccgacgaggtggagctgggcctggggatccacggggaagctggtgtgcgccggataaagatggcaaccgccgatgagattgtgaaactcatgctcgaccacatgacaaacaccaccaacgcgtcccatgtgcctgtgcagcccggctcctcagttgtgatgatggtcaacaacctgggtggcctgtcattcctggaactgggcatcatagccgacgctaccgtccgctccctggagggccgcggggtgaagattgcccgtgccctggtgggcaccttcatgtcagcactggagatgcctggcatttctctcaccctcctgctggtggatgagcctctcctgaaactgatagatgctgaaaccactgcagcagcctggcctaacgtggctgcagtctccattactgggcggaagcggagccgggtagcccctgccgagccccaggaggcccctgattccactgctgcaggaggctcagcctcgaagcggatggcgctggtgctggaacgggtgtgcagcactctcctgggcctggaggaacacctgaatgccctggaccgggctgctggtgacggcgactgtggcaccacccacagccgtgcggccagagcaatccaggagtggctgaaggagggcccaccccctgccagccctgcccagctgctctccaagttgtctgtcctgctcctggagaagatgggaggctcatctggggcgctctatggcctgttcctgactgcggctgcacagcccctgaaggccaagaccagcctcccagcctggtctgctgccatggatgccggcctggaagccatgcagaagtatggcaaggctgctccaggggacaggactatgctggattctctgtgggcagcggggcaggagctccaagcctggaagagcccaggagctgatctgttacaagtcctgaccaaagcagtcaagagtgccgaagctgcagccgaggccaccaagaatatggaagctggagccggaagagccagttatatcagctcagcacggctggagcagccagaccccggggcggtggcagctgctgccatcctccgggccatcttggaggtcttgcagagctag
Sequence Length
1728
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
54,793 Da
NCBI Official Full Name
Homo sapiens dihydroxyacetone kinase 2 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
triokinase and FMN cyclase
NCBI Official Symbol
TKFC
NCBI Official Synonym Symbols
DAK; NET45
NCBI Protein Information
triokinase/FMN cyclase
UniProt Protein Name
Triokinase/FMN cyclase
Protein Family
UniProt Gene Name
TKFC
UniProt Synonym Gene Names
DHA kinase
UniProt Entry Name
TKFC_HUMAN
NCBI Description
This gene is a member of the family of dihydroxyacetone kinases, which have a protein structure distinct from other kinases. The product of this gene phosphorylates dihydroxyacetone, and also catalyzes the formation of riboflavin 4',5'-phosphate (aka cyclin FMN) from FAD. Several alternatively spliced transcript variants have been identified, but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
Uniprot Description
DAK: Catalyzes both the phosphorylation of dihydroxyacetone and of glyceraldehyde, and the splitting of ribonucleoside diphosphate-X compounds among which FAD is the best substrate. Belongs to the dihydroxyacetone kinase (DAK) family.
Protein type: Lipid Metabolism - glycerolipid; Kinase, other; EC 4.6.1.15; EC 2.7.1.29; EC 2.7.1.28
Chromosomal Location of Human Ortholog: 11q12.2
Cellular Component: cytosol; nucleus
Molecular Function: FAD-AMP lyase (cyclizing) activity; glycerone kinase activity; protein binding; triokinase activity
Biological Process: carbohydrate phosphorylation; cellular carbohydrate metabolic process; innate immune response; regulation of innate immune response
Research Articles on DAK
Similar Products
Product Notes
The DAK tkfc (Catalog #AAA1272758) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacctcca agaagctggt gaactcggtg gctggctgtg ctgatgacgc tcttgctggc ctggtggcct gcaaccccaa cctgcagctc ctgcagggcc accgcgtggc cctccgttct gacctggaca gcctcaaggg ccgggtggca ctgctgtcgg gtgggggctc tggccatgag cctgcccatg ctggtttcat agggaagggg atgctgactg gggtcatcgc gggagctgtg ttcacctccc cggcagtggg cagcatcctg gcagccatca gggccgtggc ccaggccggc acagtgggga cgctccttat cgtgaagaac tacactgggg atcggctcaa cttcggcctg gcccgggagc aggcccgggc tgaaggcatc ccggtggaga tggtggtgat tggggacgac agcgccttca ctgtcctgaa gaaggcaggc cggcgggggc tgtgcggcac ggtgcttata cacaaggtgg caggtgctct ggctgaggct ggtgtggggc tggaggagat cgcaaagcag gtgaacgtgg tcgccaaggc catgggtacc ctgggggtga gcttatcctc ctgcagcgtc cctggttcca aacccacctt cgagctctca gccgacgagg tggagctggg cctggggatc cacggggaag ctggtgtgcg ccggataaag atggcaaccg ccgatgagat tgtgaaactc atgctcgacc acatgacaaa caccaccaac gcgtcccatg tgcctgtgca gcccggctcc tcagttgtga tgatggtcaa caacctgggt ggcctgtcat tcctggaact gggcatcata gccgacgcta ccgtccgctc cctggagggc cgcggggtga agattgcccg tgccctggtg ggcaccttca tgtcagcact ggagatgcct ggcatttctc tcaccctcct gctggtggat gagcctctcc tgaaactgat agatgctgaa accactgcag cagcctggcc taacgtggct gcagtctcca ttactgggcg gaagcggagc cgggtagccc ctgccgagcc ccaggaggcc cctgattcca ctgctgcagg aggctcagcc tcgaagcgga tggcgctggt gctggaacgg gtgtgcagca ctctcctggg cctggaggaa cacctgaatg ccctggaccg ggctgctggt gacggcgact gtggcaccac ccacagccgt gcggccagag caatccagga gtggctgaag gagggcccac cccctgccag ccctgcccag ctgctctcca agttgtctgt cctgctcctg gagaagatgg gaggctcatc tggggcgctc tatggcctgt tcctgactgc ggctgcacag cccctgaagg ccaagaccag cctcccagcc tggtctgctg ccatggatgc cggcctggaa gccatgcaga agtatggcaa ggctgctcca ggggacagga ctatgctgga ttctctgtgg gcagcggggc aggagctcca agcctggaag agcccaggag ctgatctgtt acaagtcctg accaaagcag tcaagagtgc cgaagctgca gccgaggcca ccaagaatat ggaagctgga gccggaagag ccagttatat cagctcagca cggctggagc agccagaccc cggggcggtg gcagctgctg ccatcctccg ggccatcttg gaggtcttgc agagctag. It is sometimes possible for the material contained within the vial of "DAK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
