Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KRT40 cdna clone

KRT40 cDNA Clone

Gene Names
KRT40; K40; KA36; CK-40
Synonyms
KRT40; KRT40 cDNA Clone; KRT40 cdna clone
Ordering
For Research Use Only!
Sequence
atgacttctgactgctcctccacacactgctctcctgagtcctgtggcacggcttccggttgtgcacctgcctcaagctgctccgtggaaacagcttgtctccccggtacctgtgctacatcccgatgtcagactccaagcttcctatccaggtctcgcgggctgactggttgcctcctgccatgctactttactgggagttgtaatagtccctgcttggtggggaactgtgcctggtgtgaggatggggtgttcactagcaatgagaaggagacgatgcagttcctgaatgacagactcgccagctatctggagaaggtgcgcagcctggaggagaccaacgcagagctggaatccaggatccaagaacaatgtgaacaggatatcccaatggtgtgcccggattatcagcgttacttcaacaccattgaagatctccaacaaaagatcttatgcacgaaagcagagaattctagacttgctgtacagcttgacaactgcaaactggccactgatgactttaagtcaaagtacgagagtgaactgtcccttcgccagctgttagaggctgacatcagcagcctgcatgggatcctggaggaactgaccctgtgcaaatctgatctggaggcccatgtggagtctctgaaggaagatctcctttgccttaagaaaaaccatgaagaggaagtcaacttgcttcgtgaacagcttggcgaccgcctcagtgtggagctggacactgcccccacccttgacctcaacagggtcctggatgagatgcgctgtcagtgtgaaacggtgcttgccaacaatcgcagagaagctgaagaatggttggctgttcagacagaagagctgaatcagcagcaactgtccagcgcggagcagctgcagggctgccagatggagatcttggaactgaaacgcacagccagtgctctggaaattgagctccaagcacagcaaagcctgacagaatctctggaatgcaccgtggcagaaaccgaggcccagtacagctcccagctggcccaaattcagtgtctgatcgataacctggagaaccagctggccgagatccgctgcgacctggagcgacagaaccaggagtaccaggtgctcctggacgtgaaggcccggctggagggtgagatcaacacgtactggggcctgctggacagcgaggacagcaggctttcctgtagcccatgttcgaccacatgcacctcgagcaacacttgtgagccatgctcagcctatgtcatctgcactgttgaaaactgctgcttgtga
Sequence Length
1296
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,139 Da
NCBI Official Full Name
Homo sapiens keratin 40, mRNA
NCBI Official Synonym Full Names
keratin 40
NCBI Official Symbol
KRT40
NCBI Official Synonym Symbols
K40; KA36; CK-40
NCBI Protein Information
keratin, type I cytoskeletal 40
UniProt Protein Name
Keratin, type I cytoskeletal 40
Protein Family
UniProt Gene Name
KRT40
UniProt Synonym Gene Names
KA36; CK-40; K40
UniProt Entry Name
K1C40_HUMAN

NCBI Description

This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]

Uniprot Description

KRT40 iso3: Belongs to the intermediate filament family. {ECO:0000256|SAAS:SAAS00575906}

Protein type: Cytoskeletal

Chromosomal Location of Human Ortholog: 17q21.2

Molecular Function: protein binding

Research Articles on KRT40

Similar Products

Product Notes

The KRT40 krt40 (Catalog #AAA1272506) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacttctg actgctcctc cacacactgc tctcctgagt cctgtggcac ggcttccggt tgtgcacctg cctcaagctg ctccgtggaa acagcttgtc tccccggtac ctgtgctaca tcccgatgtc agactccaag cttcctatcc aggtctcgcg ggctgactgg ttgcctcctg ccatgctact ttactgggag ttgtaatagt ccctgcttgg tggggaactg tgcctggtgt gaggatgggg tgttcactag caatgagaag gagacgatgc agttcctgaa tgacagactc gccagctatc tggagaaggt gcgcagcctg gaggagacca acgcagagct ggaatccagg atccaagaac aatgtgaaca ggatatccca atggtgtgcc cggattatca gcgttacttc aacaccattg aagatctcca acaaaagatc ttatgcacga aagcagagaa ttctagactt gctgtacagc ttgacaactg caaactggcc actgatgact ttaagtcaaa gtacgagagt gaactgtccc ttcgccagct gttagaggct gacatcagca gcctgcatgg gatcctggag gaactgaccc tgtgcaaatc tgatctggag gcccatgtgg agtctctgaa ggaagatctc ctttgcctta agaaaaacca tgaagaggaa gtcaacttgc ttcgtgaaca gcttggcgac cgcctcagtg tggagctgga cactgccccc acccttgacc tcaacagggt cctggatgag atgcgctgtc agtgtgaaac ggtgcttgcc aacaatcgca gagaagctga agaatggttg gctgttcaga cagaagagct gaatcagcag caactgtcca gcgcggagca gctgcagggc tgccagatgg agatcttgga actgaaacgc acagccagtg ctctggaaat tgagctccaa gcacagcaaa gcctgacaga atctctggaa tgcaccgtgg cagaaaccga ggcccagtac agctcccagc tggcccaaat tcagtgtctg atcgataacc tggagaacca gctggccgag atccgctgcg acctggagcg acagaaccag gagtaccagg tgctcctgga cgtgaaggcc cggctggagg gtgagatcaa cacgtactgg ggcctgctgg acagcgagga cagcaggctt tcctgtagcc catgttcgac cacatgcacc tcgagcaaca cttgtgagcc atgctcagcc tatgtcatct gcactgttga aaactgctgc ttgtga. It is sometimes possible for the material contained within the vial of "KRT40, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.