Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ITIH2 cdna clone

ITIH2 cDNA Clone

Gene Names
ITIH2; H2P; SHAP
Synonyms
ITIH2; ITIH2 cDNA Clone; ITIH2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaaagactcacgtgctttttcatctgcttctttctttctgaagtatcaggcttcgaaatccccataaatggactttctgaatttgtagactatgaagatcttgtggaactggccccaggcaaatttcaattggtggcagagaaccggagatatcagagaagccttccaggagaatcggaagaaatgatggaagaggttgatcaagtaactctttatagctataaagtccagtctactattacttctcggatggccaccaccatgatccagagcaaagtggtgaacaattccccgcagcctcagaatgtcgtgtttgatgttcagatccccaaaggagcattcatttccaacttctccatgactgtggacggcaagacatttaggagctctattaaggagaaaactgtgggccgagctctttatgcacaggccagagcaaaaggcaagacggctggcttggtgaggagcagcgctcttgatatggaaaacttcagaacggaagtaaatgtcctcccaggagcaaaggtgcagttcgaacttcactaccaggaggtgaagtggaggaagctgggctcctatgagcacaggatctatctgcaacctggacggctggccaaacacttagaggtagatgtgtgggttatcgaaccacagggactgagatttcttcatgttcccgacacatttgaaggccatttcgatggtgttccggtcatttctaaaggacaacagaaggcgcacgtctccttcaagcccacggtagcacagcagagaatatgccctagctgccgggagactgcggtagatggggaactggtggtgctgtatgacgtgaaaagagaagagaaggctggtgaactggaggtgtttaatggatattttgtccacttctttgctcctgacaacctggacccaattcccaaaaacatcctctttgtcatcgatgtgagtggctccatgtggggagttaaaatgaaacaaactgtggaagcaatgaagaccatattggatgacctcagagcagaagaccatttctctgtgattgatttcaaccagaacattcgaacttggagaaatgatttaatttcagctacaaaaacacaggttgcagatgccaagaggtatattgagaaaatccagcccagtggaggcacaaacatcaacgaagcactcctacgggcaatcttcattttgaatgaagccaataacttgggactgttagaccccaactccgtctcgctgatcattttggtttctgatggagatccaacagtgggcgaactaaaactgtcaaaaattcagaaaaacgttaaggagaacatccaagacaatatctccttgttcagtttgggcatgggatttgatgtggactatgattttttgaagagactgtccaatgaaaaccatggaattgcacaaaggatttatggaaaccaggacacgtcttcccagcttaagaaattctacaaccaggtctccactccattgctccggaatgttcagttcaactatccccatacatcagtcacggacgtcactcaaaacaatttccataactactttggaggctcagagattgtggtggcaggaaaatttgaccctgctaaattggatcaaatagagagcgttatcacggcgacttcggctaacacgcagttagtcttggagaccctggcccagatggacgacttgcaggattttctatcgaaagacaagcatgcagatcccgatttcaccaggaaactgtgggcctatctaaccatcaaccaactgctagctgaacgaagcctggctcctacagctgccgccaagagaagaattacaagatcgatcctgcagatgtctctagaccaccacattgtgactccgctgacctcgctggtgatcgagaacgaggctggggatgagcgcatgctggcggatgccccaccgcaggatccctcctgctgctcaggggccctgtattacggcagcaaagtggttccagattccaccccgtcttgggccaatccttcaccaacgcccgtgatctccatgctggcacaaggatctcaggtgctagagtccacgccacccccacatgtgatgagagttgaaaatgacccacatttcatcatttatctaccaaaaagccaaaagaacatttgtttcaatattgactcagaacctggaaaaatcctcaacctggtttctgacccagaatcaggaattgtagtcaacggtcagcttgttggtgccaagaagcccaacaatggaaaactaagcacctattttggaaaactgggattttatttccaaagtgaagacataaaaatagaaatcagcactgagaccatcaccctgagccatggttctagcacattctccttgtcctggtccgacacggctcaagtcacgaatcagagggtgcagatctcagtgaagaaagaaaaagtggtaactatcaccctggataaagagatgtccttttctgttttacttcatcgtgtttggaagaagcatcccgtcaatgttgactttctgggaatctacataccccctacaaacaagttctcacctaaagcccacggactaataggccagttcatgcaggaaccaaagatacacatcttcaatgagagaccaggaaaggaccctgagaagccagaggccagcatggaagtgaaggggcagaagctgatcatcaccaggggcttacagaaagactacagaacggatctagtgtttggaacggacgttacctgctggtttgtgcacaacagtggaaaaggattcattgacgggcattacaaggattacttcgtgcctcagctctacagctttctcaaacggccttaa
Sequence Length
2841
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
106,463 Da
NCBI Official Full Name
Homo sapiens inter-alpha (globulin) inhibitor H2, mRNA
NCBI Official Synonym Full Names
inter-alpha-trypsin inhibitor heavy chain 2
NCBI Official Symbol
ITIH2
NCBI Official Synonym Symbols
H2P; SHAP
NCBI Protein Information
inter-alpha-trypsin inhibitor heavy chain H2
UniProt Protein Name
Inter-alpha-trypsin inhibitor heavy chain H2
UniProt Gene Name
ITIH2
UniProt Synonym Gene Names
IGHEP2; ITI heavy chain H2; ITI-HC2; Inter-alpha-inhibitor heavy chain 2; SHAP
UniProt Entry Name
ITIH2_HUMAN

NCBI Description

The inter-alpha-trypsin inhibitors (ITI) are a family of structurally related plasma serine protease inhibitors involved in extracellular matrix stabilization and in prevention of tumor metastasis. The ITI family contains multiple proteins made up of a light chain (see MIM 176870) and a variable number of heavy chains (Salier et al., 1987 [PubMed 2446322]; Himmelfarb et al., 2004 [PubMed 14744536]).[supplied by OMIM, Nov 2009]

Uniprot Description

ITIH2: May act as a carrier of hyaluronan in serum or as a binding protein between hyaluronan and other matrix protein, including those on cell surfaces in tissues to regulate the localization, synthesis and degradation of hyaluronan which are essential to cells undergoing biological processes. Belongs to the ITIH family.

Protein type: Secreted, signal peptide; Secreted; Inhibitor

Chromosomal Location of Human Ortholog: 10p15

Molecular Function: endopeptidase inhibitor activity

Research Articles on ITIH2

Similar Products

Product Notes

The ITIH2 itih2 (Catalog #AAA1272340) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaaagac tcacgtgctt tttcatctgc ttctttcttt ctgaagtatc aggcttcgaa atccccataa atggactttc tgaatttgta gactatgaag atcttgtgga actggcccca ggcaaatttc aattggtggc agagaaccgg agatatcaga gaagccttcc aggagaatcg gaagaaatga tggaagaggt tgatcaagta actctttata gctataaagt ccagtctact attacttctc ggatggccac caccatgatc cagagcaaag tggtgaacaa ttccccgcag cctcagaatg tcgtgtttga tgttcagatc cccaaaggag cattcatttc caacttctcc atgactgtgg acggcaagac atttaggagc tctattaagg agaaaactgt gggccgagct ctttatgcac aggccagagc aaaaggcaag acggctggct tggtgaggag cagcgctctt gatatggaaa acttcagaac ggaagtaaat gtcctcccag gagcaaaggt gcagttcgaa cttcactacc aggaggtgaa gtggaggaag ctgggctcct atgagcacag gatctatctg caacctggac ggctggccaa acacttagag gtagatgtgt gggttatcga accacaggga ctgagatttc ttcatgttcc cgacacattt gaaggccatt tcgatggtgt tccggtcatt tctaaaggac aacagaaggc gcacgtctcc ttcaagccca cggtagcaca gcagagaata tgccctagct gccgggagac tgcggtagat ggggaactgg tggtgctgta tgacgtgaaa agagaagaga aggctggtga actggaggtg tttaatggat attttgtcca cttctttgct cctgacaacc tggacccaat tcccaaaaac atcctctttg tcatcgatgt gagtggctcc atgtggggag ttaaaatgaa acaaactgtg gaagcaatga agaccatatt ggatgacctc agagcagaag accatttctc tgtgattgat ttcaaccaga acattcgaac ttggagaaat gatttaattt cagctacaaa aacacaggtt gcagatgcca agaggtatat tgagaaaatc cagcccagtg gaggcacaaa catcaacgaa gcactcctac gggcaatctt cattttgaat gaagccaata acttgggact gttagacccc aactccgtct cgctgatcat tttggtttct gatggagatc caacagtggg cgaactaaaa ctgtcaaaaa ttcagaaaaa cgttaaggag aacatccaag acaatatctc cttgttcagt ttgggcatgg gatttgatgt ggactatgat tttttgaaga gactgtccaa tgaaaaccat ggaattgcac aaaggattta tggaaaccag gacacgtctt cccagcttaa gaaattctac aaccaggtct ccactccatt gctccggaat gttcagttca actatcccca tacatcagtc acggacgtca ctcaaaacaa tttccataac tactttggag gctcagagat tgtggtggca ggaaaatttg accctgctaa attggatcaa atagagagcg ttatcacggc gacttcggct aacacgcagt tagtcttgga gaccctggcc cagatggacg acttgcagga ttttctatcg aaagacaagc atgcagatcc cgatttcacc aggaaactgt gggcctatct aaccatcaac caactgctag ctgaacgaag cctggctcct acagctgccg ccaagagaag aattacaaga tcgatcctgc agatgtctct agaccaccac attgtgactc cgctgacctc gctggtgatc gagaacgagg ctggggatga gcgcatgctg gcggatgccc caccgcagga tccctcctgc tgctcagggg ccctgtatta cggcagcaaa gtggttccag attccacccc gtcttgggcc aatccttcac caacgcccgt gatctccatg ctggcacaag gatctcaggt gctagagtcc acgccacccc cacatgtgat gagagttgaa aatgacccac atttcatcat ttatctacca aaaagccaaa agaacatttg tttcaatatt gactcagaac ctggaaaaat cctcaacctg gtttctgacc cagaatcagg aattgtagtc aacggtcagc ttgttggtgc caagaagccc aacaatggaa aactaagcac ctattttgga aaactgggat tttatttcca aagtgaagac ataaaaatag aaatcagcac tgagaccatc accctgagcc atggttctag cacattctcc ttgtcctggt ccgacacggc tcaagtcacg aatcagaggg tgcagatctc agtgaagaaa gaaaaagtgg taactatcac cctggataaa gagatgtcct tttctgtttt acttcatcgt gtttggaaga agcatcccgt caatgttgac tttctgggaa tctacatacc ccctacaaac aagttctcac ctaaagccca cggactaata ggccagttca tgcaggaacc aaagatacac atcttcaatg agagaccagg aaaggaccct gagaagccag aggccagcat ggaagtgaag gggcagaagc tgatcatcac caggggctta cagaaagact acagaacgga tctagtgttt ggaacggacg ttacctgctg gtttgtgcac aacagtggaa aaggattcat tgacgggcat tacaaggatt acttcgtgcc tcagctctac agctttctca aacggcctta a. It is sometimes possible for the material contained within the vial of "ITIH2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.