CARKD cdna clone
CARKD cDNA Clone
Gene Names
NAXD; CARKD; LP3298
Synonyms
CARKD; CARKD cDNA Clone; CARKD cdna clone
Sequence
atggtcacacgcgcgggggccggaactgccgtcgccggcgcggtcgttgtcgcattgctctcggccgcactcgcgctgtacgggccgccactggacgcagttttagaaagagcgttttcgctacgtaaagcacattcgataaaggatatggaaaatactttgcagctggtgagaaatatcatacctcctctgtcttccacaaagcacaaagggcaagatggaagaataggcgtagttggaggctgtcaggagtacactggagccccatattttgcagcaatctcagctctcaaagtgggcgcagacttgtcccacgtgttctgtgccagtgcggccgcacctgtgattaaggcctacagcccggagctgatcgtccacccagttcttgacagccccaatgctgttcatgaggtggagaagtggctgccccggctgcatgctcttgtcgtaggacctggcttgggtagagatgatgcgcttctcagaaatgtccagggcattttggaagtgtcaaaggccagggacatccctgttgtcatcgacgcggatggcctgtggctggtcgctcagcagccggccctcatccatggctaccggaaggctgtgctcactcccaaccacgtggagttcagcagactgtatgacgctgtgctcagaggccctatggacagcgatgacagccatggatctgtgctaagactcagccaagccctgggcaacgtgacggtggtccagaaaggagagcgcgacatcctctccaacggccagcaggtgcttgtgtgcagccaggaaggcagcagccgcaggtgtggagggcaaggggacctcctgtcgggctccctgggcgtcctggtacactgggcgctccttgctggaccacagaaaacaaatgggtccagccctctcctggtggccgcgtttggcgcctgctctctcaccaggcagtgcaaccaccaagccttccagaagcacggtcgctccaccaccacctccgacatgatcgccgaggtgggggccgccttcagcaagctctttgaaacctga
Sequence Length
1044
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
25,200 Da
NCBI Official Full Name
Homo sapiens carbohydrate kinase domain containing, mRNA
NCBI Official Synonym Full Names
NAD(P)HX dehydratase
NCBI Official Symbol
NAXD
NCBI Official Synonym Symbols
CARKD; LP3298
NCBI Protein Information
ATP-dependent (S)-NAD(P)H-hydrate dehydratase
UniProt Protein Name
ATP-dependent (S)-NAD(P)H-hydrate dehydratase
UniProt Gene Name
NAXD
UniProt Entry Name
NNRD_HUMAN
Uniprot Description
CARKD: Catalyzes the dehydration of the S-form of NAD(P)HX at the expense of ATP, which is converted to ADP. Together with NAD(P)HX epimerase, which catalyzes the epimerization of the S- and R-forms, the enzyme allows the repair of both epimers of NAD(P)HX, a damaged form of NAD(P)H that is a result of enzymatic or heat-dependent hydration. Belongs to the nnrD/CARKD family. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 4.2.1.93
Chromosomal Location of Human Ortholog: 13q34
Cellular Component: mitochondrial matrix
Molecular Function: ATP-dependent NAD(P)H-hydrate dehydratase activity; protein binding
Biological Process: nicotinamide metabolic process
Research Articles on CARKD
Similar Products
Product Notes
The CARKD naxd (Catalog #AAA1272210) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtcacac gcgcgggggc cggaactgcc gtcgccggcg cggtcgttgt cgcattgctc tcggccgcac tcgcgctgta cgggccgcca ctggacgcag ttttagaaag agcgttttcg ctacgtaaag cacattcgat aaaggatatg gaaaatactt tgcagctggt gagaaatatc atacctcctc tgtcttccac aaagcacaaa gggcaagatg gaagaatagg cgtagttgga ggctgtcagg agtacactgg agccccatat tttgcagcaa tctcagctct caaagtgggc gcagacttgt cccacgtgtt ctgtgccagt gcggccgcac ctgtgattaa ggcctacagc ccggagctga tcgtccaccc agttcttgac agccccaatg ctgttcatga ggtggagaag tggctgcccc ggctgcatgc tcttgtcgta ggacctggct tgggtagaga tgatgcgctt ctcagaaatg tccagggcat tttggaagtg tcaaaggcca gggacatccc tgttgtcatc gacgcggatg gcctgtggct ggtcgctcag cagccggccc tcatccatgg ctaccggaag gctgtgctca ctcccaacca cgtggagttc agcagactgt atgacgctgt gctcagaggc cctatggaca gcgatgacag ccatggatct gtgctaagac tcagccaagc cctgggcaac gtgacggtgg tccagaaagg agagcgcgac atcctctcca acggccagca ggtgcttgtg tgcagccagg aaggcagcag ccgcaggtgt ggagggcaag gggacctcct gtcgggctcc ctgggcgtcc tggtacactg ggcgctcctt gctggaccac agaaaacaaa tgggtccagc cctctcctgg tggccgcgtt tggcgcctgc tctctcacca ggcagtgcaa ccaccaagcc ttccagaagc acggtcgctc caccaccacc tccgacatga tcgccgaggt gggggccgcc ttcagcaagc tctttgaaac ctga. It is sometimes possible for the material contained within the vial of "CARKD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
