RASL10A cdna clone
RASL10A cDNA Clone
Gene Names
RASL10A; RRP22
Synonyms
RASL10A; RASL10A cDNA Clone; RASL10A cdna clone
Sequence
atggggggtagcctgcgggtggccgttctaggcgccccgggcgtgggcaagacggccatcatccgccagttcctgttcggtgactaccccgagcgccaccggcccacggacgggccgcgcctctaccgacccgcggtgctgctcgacggcgccgtctacgacttgagcatccgcgacggcgacgtcgctggccccggctcgagccccgggggtccggaggagtggccagacgctaaggactggagcttgcaggacacggacgccttcgtgctcgtctacgacatctgcagcccggacagtttcgactacgtgaaggccctgcggcagcgcatcgcggagaccaggccggcgggcgcgcccgaagcgcccatcctcgtggtaggcaacaagcgggacaggcagcggctgcgcttcggaccgcggcgcgcgctggccgccctagtgcgcaggggctggcgctgcggctacctcgagtgctccgccaagtacaactggcacgtgctgcgtctcttccgcgagctgctgcgctgcgctctggtgcgcgcgcgccctgcacacccggccctgcgcctgcagggggcgctgcatcccgcgcgctgcagcctcatgtga
Sequence Length
612
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
12,537 Da
NCBI Official Full Name
Homo sapiens RAS-like, family 10, member A, mRNA
NCBI Official Synonym Full Names
RAS like family 10 member A
NCBI Official Symbol
RASL10A
NCBI Official Synonym Symbols
RRP22
NCBI Protein Information
ras-like protein family member 10A
UniProt Protein Name
Ras-like protein family member 10A
Protein Family
UniProt Gene Name
RASL10A
UniProt Synonym Gene Names
RRP22
UniProt Entry Name
RSLAA_HUMAN
Uniprot Description
RASL10A: Potent inhibitor of cellular proliferation. Belongs to the small GTPase superfamily. Ras family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: G protein; G protein, monomeric, Ras; Tumor suppressor; G protein, monomeric; Nucleolus
Chromosomal Location of Human Ortholog: 22q12.2
Molecular Function: GTPase activity
Research Articles on RASL10A
Similar Products
Product Notes
The RASL10A rasl10a (Catalog #AAA1272119) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggggta gcctgcgggt ggccgttcta ggcgccccgg gcgtgggcaa gacggccatc atccgccagt tcctgttcgg tgactacccc gagcgccacc ggcccacgga cgggccgcgc ctctaccgac ccgcggtgct gctcgacggc gccgtctacg acttgagcat ccgcgacggc gacgtcgctg gccccggctc gagccccggg ggtccggagg agtggccaga cgctaaggac tggagcttgc aggacacgga cgccttcgtg ctcgtctacg acatctgcag cccggacagt ttcgactacg tgaaggccct gcggcagcgc atcgcggaga ccaggccggc gggcgcgccc gaagcgccca tcctcgtggt aggcaacaag cgggacaggc agcggctgcg cttcggaccg cggcgcgcgc tggccgccct agtgcgcagg ggctggcgct gcggctacct cgagtgctcc gccaagtaca actggcacgt gctgcgtctc ttccgcgagc tgctgcgctg cgctctggtg cgcgcgcgcc ctgcacaccc ggccctgcgc ctgcaggggg cgctgcatcc cgcgcgctgc agcctcatgt ga. It is sometimes possible for the material contained within the vial of "RASL10A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
