Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ATP6V0A2 cdna clone

ATP6V0A2 cDNA Clone

Gene Names
ATP6V0A2; A2; RTF; TJ6; WSS; ARCL; J6B7; STV1; TJ6M; TJ6S; VPH1; ARCL2A; ATP6A2; ATP6N1D
Synonyms
ATP6V0A2; ATP6V0A2 cDNA Clone; ATP6V0A2 cdna clone
Ordering
For Research Use Only!
Sequence
atggggtccctgttccggagcgagaccatgtgcctggcgcagctcttcctgcagtcgggcacggcctacgagtgcctcagcgccctgggcgagaaaggcctggtccagttccgagacctcaaccagaacgtaagttctttccaaagaaaatttgttggtgaggtgaagaggtgtgaagagctagagcgaatattggtgtatttggtacaggaaattaatagagctgatattccccttcctgaaggagaggccagccctcctgcgccacccctgaaacaggttctagaaatgcaggagcagttgcagaagctcgaggttgaactgagagaagtcactaagaacaaggagaaactgaggaaaaacttgctggaactgatagagtacactcacatgctgagagtgacaaagacctttgtgaaacgcaacgttgagtttgaacccacttatgaagaattcccttccttagagagcgattctttgttggattacagctgtatgcagaggctgggagcaaaactgggatttgtgtctggcctaattaaccaaggaaaagtggaagcatttgaaaaaatgttgtggagagtctgcaaagggtacaccatcgtgtcctatgcagaactggatgaatcccttgaagaccctgaaacaggggaagtcataaaatggtatgtctttttaatatccttttggggagagcagattggccacaaggttaagaagatatgtgattgctaccactgccacgtgtacccctatccaaacacagccgaggagcggagggagatccaggaggggctgaacacccgcatccaggatctctacactgtactgcacaaaaccgaggactatttgaggcaagtgctatgtaaagccgccgagtctgtctacagccgtgtgatccaggtgaagaaaatgaaggccatctatcacatgctgaacatgtgcagctttgacgtgaccaacaagtgcctcattgctgaggtctggtgtcccgaggcggatctgcaggacctgcgccgggcactggaggagggctcgagagagagtggtgctacaatcccctcattcatgaatataatccccacaaaagaaacaccccccactcggatccgcaccaacaaattcaccgagggatttcagaacatcgtggatgcttatggagtcggaagctacagagaagtcaatccagctctctttaccatcatcaccttcccgtttttatttgctgtgatgtttggagacttcggacatggctttgtgatgtttttatttgccctcttgttggtgttaaatgaaaatcatcccagactaaatcagtcacaagagatcatgaggatgttttttaatggccggtacatcctcctgctgatggggctgttctcagtgtacactggcctcatctacaacgactgcttttcaaagtcagtcaacctgttcggctctgggtggaacgtgtcggccatgtacagctccagccacccacccgcagagcataagaagatggtgctttggaacgacagcgtcgttagacacaacagcattttgcagctggatccaagcattcctggagtgttccgaggcccttatccccttggcattgatcctatttggaacttggccacaaatcgcctcacttttctaaactctttcaaaatgaaaatgtccgtgattttaggaatcattcatatgacttttggagtcattctgggaatatttaaccacttgcacttcaggaagaagttcaacatttacctggtttccatcccggaacttctcttcatgctctgtatctttggataccttatatttatgattttctacaagtggctggttttttcagcagaaacctccagagttgctcccagcattctgattgaatttattaacatgtttttattcccagccagtaaaacaagtggcctttacacagggcaggagtatgtccagagagtgctgctggttgtcacagcattgtctgtccctgtcctcttcttgggaaagccactgtttttgttgtggcttcacaatgggcgtagttgcttcggggtgaaccggagtggctacacacttataaggaaagatagtgaggaagaagtttcattgctgggaagccaagatatagaagagggaaatcaccaggtggaagatggatgtagagaaatggcgtgtgaagagtttaattttggagaaatattaatgacccaagtaatccattccatcgagtactgtctgggatgcatctccaacaccgcctcctacctgaggctctgggcgcttagcctggctcacgcacagttgtctgatgtcctgtgggccatgctgatgcgcgtgggcctccgcgttgacaccacctatggcgtcttgctactgctcccggttatcgcgctctttgcagttttgaccattttcatccttctgatcatggaagggctttctgcgtttcttcacgccatacgcctccactgggtagaatttcagaacaaattctacgttggtgcaggcaccaaatttgttcctttctcattcagtctactttcatcaaagttcaataacgacgacagtgtggcatga
Sequence Length
2571
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
98,082 Da
NCBI Official Full Name
Homo sapiens ATPase, H+ transporting, lysosomal V0 subunit a2, mRNA
NCBI Official Synonym Full Names
ATPase H+ transporting V0 subunit a2
NCBI Official Symbol
ATP6V0A2
NCBI Official Synonym Symbols
A2; RTF; TJ6; WSS; ARCL; J6B7; STV1; TJ6M; TJ6S; VPH1; ARCL2A; ATP6A2; ATP6N1D
NCBI Protein Information
V-type proton ATPase 116 kDa subunit a isoform 2
UniProt Protein Name
V-type proton ATPase 116 kDa subunit a isoform 2
Protein Family
UniProt Gene Name
ATP6V0A2
UniProt Synonym Gene Names
V-ATPase 116 kDa isoform a2
UniProt Entry Name
VPP2_HUMAN

NCBI Description

The protein encoded by this gene is a subunit of the vacuolar ATPase (v-ATPase), an heteromultimeric enzyme that is present in intracellular vesicles and in the plasma membrane of specialized cells, and which is essential for the acidification of diverse cellular components. V-ATPase is comprised of a membrane peripheral V(1) domain for ATP hydrolysis, and an integral membrane V(0) domain for proton translocation. The subunit encoded by this gene is a component of the V(0) domain. Mutations in this gene are a cause of both cutis laxa type II and wrinkly skin syndrome. [provided by RefSeq, Jul 2009]

Uniprot Description

ATP6V0A2: Part of the proton channel of V-ATPases. Essential component of the endosomal pH-sensing machinery. May play a role in maintaining the Golgi functions, such as glycosylation maturation, by controlling the Golgi pH. Defects in ATP6V0A2 are the cause of cutis laxa autosomal recessive type 2A (ARCL2A). An autosomal recessive disorder characterized by an excessive congenital skin wrinkling, a large fontanelle with delayed closure, a typical facial appearance with downslanting palpebral fissures, a general connective tissue weakness, and varying degrees of growth and developmental delay and neurological abnormalities. Some affected individuals develop seizures and mental deterioration later in life, whereas the skin phenotype tends to become milder with age. At the molecular level, an abnormal glycosylation of serum proteins is observed in many cases. Defects in ATP6V0A2 are a cause of wrinkly skin syndrome (WSS). WSS is rare autosomal recessive disorder characterized by wrinkling of the skin of the dorsum of the hands and feet, an increased number of palmar and plantar creases, wrinkled abdominal skin, multiple musculoskeletal abnormalities, microcephaly, growth failure and developmental delay. Belongs to the V-ATPase 116 kDa subunit family.

Protein type: Transporter, ion channel; Membrane protein, integral; Transporter, iron; Membrane protein, multi-pass; Energy Metabolism - oxidative phosphorylation; Transporter

Chromosomal Location of Human Ortholog: 12q24.31

Cellular Component: cytoplasm; endosome membrane; focal adhesion; lysosomal membrane; phagocytic vesicle membrane; plasma membrane; vacuolar proton-transporting V-type ATPase complex

Molecular Function: ATPase binding; hydrogen ion transporting ATPase activity, rotational mechanism; protein binding

Biological Process: ATP synthesis coupled proton transport; immune response; insulin receptor signaling pathway; transferrin transport; vacuolar acidification

Disease: Cutis Laxa, Autosomal Recessive, Type Iia; Wrinkly Skin Syndrome

Research Articles on ATP6V0A2

Similar Products

Product Notes

The ATP6V0A2 atp6v0a2 (Catalog #AAA1271814) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggtccc tgttccggag cgagaccatg tgcctggcgc agctcttcct gcagtcgggc acggcctacg agtgcctcag cgccctgggc gagaaaggcc tggtccagtt ccgagacctc aaccagaacg taagttcttt ccaaagaaaa tttgttggtg aggtgaagag gtgtgaagag ctagagcgaa tattggtgta tttggtacag gaaattaata gagctgatat tccccttcct gaaggagagg ccagccctcc tgcgccaccc ctgaaacagg ttctagaaat gcaggagcag ttgcagaagc tcgaggttga actgagagaa gtcactaaga acaaggagaa actgaggaaa aacttgctgg aactgataga gtacactcac atgctgagag tgacaaagac ctttgtgaaa cgcaacgttg agtttgaacc cacttatgaa gaattccctt ccttagagag cgattctttg ttggattaca gctgtatgca gaggctggga gcaaaactgg gatttgtgtc tggcctaatt aaccaaggaa aagtggaagc atttgaaaaa atgttgtgga gagtctgcaa agggtacacc atcgtgtcct atgcagaact ggatgaatcc cttgaagacc ctgaaacagg ggaagtcata aaatggtatg tctttttaat atccttttgg ggagagcaga ttggccacaa ggttaagaag atatgtgatt gctaccactg ccacgtgtac ccctatccaa acacagccga ggagcggagg gagatccagg aggggctgaa cacccgcatc caggatctct acactgtact gcacaaaacc gaggactatt tgaggcaagt gctatgtaaa gccgccgagt ctgtctacag ccgtgtgatc caggtgaaga aaatgaaggc catctatcac atgctgaaca tgtgcagctt tgacgtgacc aacaagtgcc tcattgctga ggtctggtgt cccgaggcgg atctgcagga cctgcgccgg gcactggagg agggctcgag agagagtggt gctacaatcc cctcattcat gaatataatc cccacaaaag aaacaccccc cactcggatc cgcaccaaca aattcaccga gggatttcag aacatcgtgg atgcttatgg agtcggaagc tacagagaag tcaatccagc tctctttacc atcatcacct tcccgttttt atttgctgtg atgtttggag acttcggaca tggctttgtg atgtttttat ttgccctctt gttggtgtta aatgaaaatc atcccagact aaatcagtca caagagatca tgaggatgtt ttttaatggc cggtacatcc tcctgctgat ggggctgttc tcagtgtaca ctggcctcat ctacaacgac tgcttttcaa agtcagtcaa cctgttcggc tctgggtgga acgtgtcggc catgtacagc tccagccacc cacccgcaga gcataagaag atggtgcttt ggaacgacag cgtcgttaga cacaacagca ttttgcagct ggatccaagc attcctggag tgttccgagg cccttatccc cttggcattg atcctatttg gaacttggcc acaaatcgcc tcacttttct aaactctttc aaaatgaaaa tgtccgtgat tttaggaatc attcatatga cttttggagt cattctggga atatttaacc acttgcactt caggaagaag ttcaacattt acctggtttc catcccggaa cttctcttca tgctctgtat ctttggatac cttatattta tgattttcta caagtggctg gttttttcag cagaaacctc cagagttgct cccagcattc tgattgaatt tattaacatg tttttattcc cagccagtaa aacaagtggc ctttacacag ggcaggagta tgtccagaga gtgctgctgg ttgtcacagc attgtctgtc cctgtcctct tcttgggaaa gccactgttt ttgttgtggc ttcacaatgg gcgtagttgc ttcggggtga accggagtgg ctacacactt ataaggaaag atagtgagga agaagtttca ttgctgggaa gccaagatat agaagaggga aatcaccagg tggaagatgg atgtagagaa atggcgtgtg aagagtttaa ttttggagaa atattaatga cccaagtaat ccattccatc gagtactgtc tgggatgcat ctccaacacc gcctcctacc tgaggctctg ggcgcttagc ctggctcacg cacagttgtc tgatgtcctg tgggccatgc tgatgcgcgt gggcctccgc gttgacacca cctatggcgt cttgctactg ctcccggtta tcgcgctctt tgcagttttg accattttca tccttctgat catggaaggg ctttctgcgt ttcttcacgc catacgcctc cactgggtag aatttcagaa caaattctac gttggtgcag gcaccaaatt tgttcctttc tcattcagtc tactttcatc aaagttcaat aacgacgaca gtgtggcatg a. It is sometimes possible for the material contained within the vial of "ATP6V0A2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.