Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC2A6 cdna clone

SLC2A6 cDNA Clone

Gene Names
SLC2A6; GLUT6; GLUT9; HSA011372
Synonyms
SLC2A6; SLC2A6 cDNA Clone; SLC2A6 cdna clone
Ordering
For Research Use Only!
Sequence
atgcaggagccgctgctgggagccgagggcccggactacgacaccttccccgagaagccgcccccgtcgccaggggacagggcgcgggtcgggaccctgcagaacaaaagggtgttcctggccaccttcgccgcagtgctcggcaatttcagctttgggtatgccctggtctacacatcccctgtcatcccagccctggagcgctccttggatcctgacctgcatctgaccaaatcccaggcatcctggtttgggtccgtgttcaccctgggagcagcggccggaggcctgagtgccatgatcctcaacgacctcctgggccggaagctgagcatcatgttctcagctgtgccgtcggcggccggctatgcgctcatggcgggtgcgcacggcctctggatgctgctgctcggaaggacgctgacgggcttcgccggggggctcacagctgcctgcatcccggtgtacgtgtctgagattgctcccccaggcgttcgtggggctctgggggccacaccccagctcatggcagtgttcggatccctgtccctctacgcccttggcctcctgctgccgtggcgctggctggctgtggccggggaggcgcctgtgctcatcatgatcctgctgctcagcttcatgcccaactcgccgcgcttcctgctctctcggggcagggacgaagaggccctgcgggcgctggcctggctgcgtgggacggacgtcgatgtccactgggagttcgagcagatccaggacaacgtccggagacagagcagccgagtatcgtgggctgaggcacgggccccccacgtgtgccggcccatcaccgtggccttgctgatgcgcctcctgcagcagctgacgggcatcacgcccatcctggtctacctgcagtccatcttcgacagcaccgctgtcctgctgccccccaaggacgacgcagccatcgttggggccgtgcggctcctgtccgtgctgatcgccgccctcaccatggacctcgcaggccgcaaggtgctgctcttcgtctcagcggccatcatgtttgctgccaacctgactctggggctgtacatccactttggccccaggcctctgagccccaacagcactgcgggcctggaaagcgagtcctggggggacttggcgcagcccctggcagcacccgctggctacctcaccctggtgcccctgctggccaccatgctcttcatcatgggctacgccgtgggctggggtcccatcacctggctgctcatgtctgaggtcctgcccctgcgtgcccgtggcgtggcctcagggctctgcgtgctggccagctggctcaccgccttcgtcctcaccaagtccttcctgccagtggtgagcaccttcggcctccaggtgcctttcttcttcttcgcggccatctgcttggtgagcctggtgttcacaggctgctgtgtgcccgagaccaagggacggtccctggagcagatcgagtccttcttccgcacggggagaaggtccttcttgcgctag
Sequence Length
1524
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,041 Da
NCBI Official Full Name
Homo sapiens solute carrier family 2 (facilitated glucose transporter), member 6, mRNA
NCBI Official Synonym Full Names
solute carrier family 2 member 6
NCBI Official Symbol
SLC2A6
NCBI Official Synonym Symbols
GLUT6; GLUT9; HSA011372
NCBI Protein Information
solute carrier family 2, facilitated glucose transporter member 6
UniProt Protein Name
Solute carrier family 2, facilitated glucose transporter member 6
Protein Family
UniProt Gene Name
SLC2A6
UniProt Synonym Gene Names
GLUT9; GLUT-6; GLUT-9
UniProt Entry Name
GTR6_HUMAN

NCBI Description

Hexose transport into mammalian cells is catalyzed by a family of membrane proteins, including SLC2A6, that contain 12 transmembrane domains and a number of critical conserved residues.[supplied by OMIM, Jul 2002]

Uniprot Description

GLUT6: an integral membrane facilitative glucose transporter. One of 13 members of the human equilibrative glucose transport protein family. Binds cytochalasin B with low affinity.

Protein type: Membrane protein, multi-pass; Transporter, SLC family; Membrane protein, integral; Transporter

Chromosomal Location of Human Ortholog: 9q34

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: D-glucose transmembrane transporter activity; glucose transmembrane transporter activity; sugar:hydrogen ion symporter activity

Biological Process: glucose import

Research Articles on SLC2A6

Similar Products

Product Notes

The SLC2A6 slc2a6 (Catalog #AAA1271230) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggagc cgctgctggg agccgagggc ccggactacg acaccttccc cgagaagccg cccccgtcgc caggggacag ggcgcgggtc gggaccctgc agaacaaaag ggtgttcctg gccaccttcg ccgcagtgct cggcaatttc agctttgggt atgccctggt ctacacatcc cctgtcatcc cagccctgga gcgctccttg gatcctgacc tgcatctgac caaatcccag gcatcctggt ttgggtccgt gttcaccctg ggagcagcgg ccggaggcct gagtgccatg atcctcaacg acctcctggg ccggaagctg agcatcatgt tctcagctgt gccgtcggcg gccggctatg cgctcatggc gggtgcgcac ggcctctgga tgctgctgct cggaaggacg ctgacgggct tcgccggggg gctcacagct gcctgcatcc cggtgtacgt gtctgagatt gctcccccag gcgttcgtgg ggctctgggg gccacacccc agctcatggc agtgttcgga tccctgtccc tctacgccct tggcctcctg ctgccgtggc gctggctggc tgtggccggg gaggcgcctg tgctcatcat gatcctgctg ctcagcttca tgcccaactc gccgcgcttc ctgctctctc ggggcaggga cgaagaggcc ctgcgggcgc tggcctggct gcgtgggacg gacgtcgatg tccactggga gttcgagcag atccaggaca acgtccggag acagagcagc cgagtatcgt gggctgaggc acgggccccc cacgtgtgcc ggcccatcac cgtggccttg ctgatgcgcc tcctgcagca gctgacgggc atcacgccca tcctggtcta cctgcagtcc atcttcgaca gcaccgctgt cctgctgccc cccaaggacg acgcagccat cgttggggcc gtgcggctcc tgtccgtgct gatcgccgcc ctcaccatgg acctcgcagg ccgcaaggtg ctgctcttcg tctcagcggc catcatgttt gctgccaacc tgactctggg gctgtacatc cactttggcc ccaggcctct gagccccaac agcactgcgg gcctggaaag cgagtcctgg ggggacttgg cgcagcccct ggcagcaccc gctggctacc tcaccctggt gcccctgctg gccaccatgc tcttcatcat gggctacgcc gtgggctggg gtcccatcac ctggctgctc atgtctgagg tcctgcccct gcgtgcccgt ggcgtggcct cagggctctg cgtgctggcc agctggctca ccgccttcgt cctcaccaag tccttcctgc cagtggtgag caccttcggc ctccaggtgc ctttcttctt cttcgcggcc atctgcttgg tgagcctggt gttcacaggc tgctgtgtgc ccgagaccaa gggacggtcc ctggagcaga tcgagtcctt cttccgcacg gggagaaggt ccttcttgcg ctag. It is sometimes possible for the material contained within the vial of "SLC2A6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.