Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SETX cdna clone

SETX cDNA Clone

Gene Names
SETX; ALS4; AOA2; SCAR1; bA479K20.2
Synonyms
SETX; SETX cDNA Clone; SETX cdna clone
Ordering
For Research Use Only!
Sequence
atgcgtaatgggaaaactgagtgttacctttccatccagactcaagagaactttccggccaatttaaacgaacttgtgaattgtattgtaatcagttctctggtaactacacaaaggaagttgaaagccatgtctctgttgggtagtcggaaccaactggctagagctgttctgaatccaaaccctatggacttctgtacaaaagatttactgactacaacatctgagagaattattgcgtacttaagagatttcaatgaagatcaaaagaaagcaatagaaactgcatatgctatggtgaaacactcaccatcagttgccaaaatctgcttgattcatggaccacctggaacaggaaaatcaaaaactattgttggcctcctctatcgtctactgacagagaaccagaggaaggggcattcagacgaaaactccaatgccaaaatcaaacaaaaccgtgtcctcgtgtgtgcaccttccaatgcagctgttgatgaactcatgaaaaaaattatccttgaattcaaagaaaaatgtaaagacaagaagaatcctttaggaaactgtggagatataaatttagtacgactgggtccagaaaagtctattaatagtgaggttctaaagttcagtttggacagccaagtaaaccacagaatgaaaaaagagttaccttctcatgttcaggcgatgcataaaagaaaggaatttctagattatcagctggatgagctttcccggcagcgagctctatgccgaggtggacgggaaatacagaggcaagaattagatgaaaacatttccaaagtttctaaggaaaggcaggaacttgcttctaaaattaaagaggttcaaggacgcccacagaaaacacagagtatcatcatcttagagtcccatatcatctgctgcacgttgagcacaagtggtggtttactacttgagtctgctttccgtgggcaagggggtgtccccttcagctgtgtcattgttgatgaggctggacagtcttgtgaaattgagactcttactccactcatccatcgctgcaataagctcatcctagtaggagatcctaagcagctccctccgacagtcatctctatgaaagcacaggagtatggctacgaccagtcaatgatggctcgcttctgcagactgctggaagagaatgtagaacacaacatgatcagcaggctgcccattctacagctcactgttcagtacaggatgcatccagacatatgcctcttcccttctaattatgtttataacagaaacttaaaaacaaatagacagacagaagccattcgatgttcatcagattggccatttcagccataccttgtgtttgatgttggagatggttcagaaagacgggataatgactcatatataaatgttcaagaaataaaactggtgatggaaataattaagcttattaaagacaaaagaaaggatgttagttttcgaaacattggcataataactcattacaaggcccagaagacgatgattcagaaggatttggacaaagagttcgatagaaaaggaccagcagaagtagacactgtggatgcattccagggtcggcagaaggattgtgttattgttacgtgtgtcagagcaaatagcatccaaggttcaattggattcctggcaagtttgcagagattgaatgtcaccatcacacgagccaagtacagcctcttcatcctcggacatttgaggaccctgatggaaaaccagcattggaatcagctgattcaggatgctcagaagcgtggtgccattattaagacctgtgacaaaaactatagacatgatgcagtgaagattctgaaactcaagcctgtgctgcagagaagtctcactcaccctcctaccatagccccagaggggtccagaccccagggtggtttgcccagcagcaagctagacagtggatttgccaagacatctgttgctgcttctctataccacacaccctctgactccaaggaaattactcttactgttacttcaaaggaccctgaaagacctcctgttcatgaccaacttcaggacccacgactgctgaagaggatgggcattgaggtcaaaggaggaatattcctttgggatccacaaccctcgagcccccagcatcctggagcaacacctcctacgggcgagccgggcttccctgtcgttcaccaggacctgagccatatacagcagcccgctgctgtagtggctgctctgagcagccacaaacctcccgtgcggggcgaacctccagctgccagtcccgaggcttccacgtgtcagagcaaatgtgatgacccggaagaggagctctgtcacaggagagaggccagggctttcagtgaaggggagcaggagaagtgtggttccgagacccatcacaccaggaggaactctaggtgggacaagaggacactggagcaggaggacagcagttccaagaaaagaaagcttttatag
Sequence Length
2487
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
306,341 Da
NCBI Official Full Name
Homo sapiens senataxin, mRNA
NCBI Official Synonym Full Names
senataxin
NCBI Official Symbol
SETX
NCBI Official Synonym Symbols
ALS4; AOA2; SCAR1; bA479K20.2
NCBI Protein Information
probable helicase senataxin
UniProt Protein Name
Probable helicase senataxin
UniProt Gene Name
SETX
UniProt Entry Name
SETX_HUMAN

NCBI Description

This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]

Uniprot Description

senataxin: Probable helicase, which may be involved in RNA maturation. Involved in DNA double-strand breaks damage response generated by oxidative stress. Defects in SETX are the cause of spinocerebellar ataxia autosomal recessive type 1 (SCAR1); also known as ataxia-ocular apraxia 2. Spinocerebellar ataxia is a clinically and genetically heterogeneous group of cerebellar disorders. Patients show progressive incoordination of gait and often poor coordination of hands, speech and eye movements, due to degeneration of the cerebellum with variable involvement of the brainstem and spinal cord. SCAR1 is an autosomal recessive form associated with peripheral neuropathy and elevated serum alpha- fetoprotein, immunoglobulins and, less commonly, creatine kinase levels. Some SCAR1 patients manifest oculomotor apraxia. Defects in SETX are a cause of amyotrophic lateral sclerosis type 4 (ALS4). ALS4 is a familial form of amyotrophic lateral sclerosis, a neurodegenerative disorder affecting upper and lower motor neurons and resulting in fatal paralysis. Sensory abnormalities are absent. Death usually occurs within 2 to 5 years. The etiology of amyotrophic lateral sclerosis is likely to be multifactorial, involving both genetic and environmental factors. The disease is inherited in 5-10% of cases leading to familial forms. ALS4 is a childhood- or adolescent- onset form characterized by slow disease progression and the sparing of bulbar and respiratory muscles. Belongs to the DNA2/NAM7 helicase family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Helicase; EC 3.6.4.-; EC 3.6.1.-; Nucleolus

Chromosomal Location of Human Ortholog: 9q34.13

Cellular Component: axon; cytoplasm; growth cone; nuclear chromosome; nucleoplasm; nucleus

Molecular Function: DNA binding; DNA helicase activity; identical protein binding; protein binding

Biological Process: double-strand break repair; fibroblast growth factor receptor signaling pathway; MAPKKK cascade; mRNA splice site selection; negative regulation of apoptosis; positive regulation of RNA splicing; positive regulation of transcription from RNA polymerase II promoter; protein kinase B signaling cascade; response to DNA damage stimulus; RNA processing; transcription termination

Disease: Amyotrophic Lateral Sclerosis 4, Juvenile; Spinocerebellar Ataxia, Autosomal Recessive 1

Research Articles on SETX

Similar Products

Product Notes

The SETX setx (Catalog #AAA1270965) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgtaatg ggaaaactga gtgttacctt tccatccaga ctcaagagaa ctttccggcc aatttaaacg aacttgtgaa ttgtattgta atcagttctc tggtaactac acaaaggaag ttgaaagcca tgtctctgtt gggtagtcgg aaccaactgg ctagagctgt tctgaatcca aaccctatgg acttctgtac aaaagattta ctgactacaa catctgagag aattattgcg tacttaagag atttcaatga agatcaaaag aaagcaatag aaactgcata tgctatggtg aaacactcac catcagttgc caaaatctgc ttgattcatg gaccacctgg aacaggaaaa tcaaaaacta ttgttggcct cctctatcgt ctactgacag agaaccagag gaaggggcat tcagacgaaa actccaatgc caaaatcaaa caaaaccgtg tcctcgtgtg tgcaccttcc aatgcagctg ttgatgaact catgaaaaaa attatccttg aattcaaaga aaaatgtaaa gacaagaaga atcctttagg aaactgtgga gatataaatt tagtacgact gggtccagaa aagtctatta atagtgaggt tctaaagttc agtttggaca gccaagtaaa ccacagaatg aaaaaagagt taccttctca tgttcaggcg atgcataaaa gaaaggaatt tctagattat cagctggatg agctttcccg gcagcgagct ctatgccgag gtggacggga aatacagagg caagaattag atgaaaacat ttccaaagtt tctaaggaaa ggcaggaact tgcttctaaa attaaagagg ttcaaggacg cccacagaaa acacagagta tcatcatctt agagtcccat atcatctgct gcacgttgag cacaagtggt ggtttactac ttgagtctgc tttccgtggg caagggggtg tccccttcag ctgtgtcatt gttgatgagg ctggacagtc ttgtgaaatt gagactctta ctccactcat ccatcgctgc aataagctca tcctagtagg agatcctaag cagctccctc cgacagtcat ctctatgaaa gcacaggagt atggctacga ccagtcaatg atggctcgct tctgcagact gctggaagag aatgtagaac acaacatgat cagcaggctg cccattctac agctcactgt tcagtacagg atgcatccag acatatgcct cttcccttct aattatgttt ataacagaaa cttaaaaaca aatagacaga cagaagccat tcgatgttca tcagattggc catttcagcc ataccttgtg tttgatgttg gagatggttc agaaagacgg gataatgact catatataaa tgttcaagaa ataaaactgg tgatggaaat aattaagctt attaaagaca aaagaaagga tgttagtttt cgaaacattg gcataataac tcattacaag gcccagaaga cgatgattca gaaggatttg gacaaagagt tcgatagaaa aggaccagca gaagtagaca ctgtggatgc attccagggt cggcagaagg attgtgttat tgttacgtgt gtcagagcaa atagcatcca aggttcaatt ggattcctgg caagtttgca gagattgaat gtcaccatca cacgagccaa gtacagcctc ttcatcctcg gacatttgag gaccctgatg gaaaaccagc attggaatca gctgattcag gatgctcaga agcgtggtgc cattattaag acctgtgaca aaaactatag acatgatgca gtgaagattc tgaaactcaa gcctgtgctg cagagaagtc tcactcaccc tcctaccata gccccagagg ggtccagacc ccagggtggt ttgcccagca gcaagctaga cagtggattt gccaagacat ctgttgctgc ttctctatac cacacaccct ctgactccaa ggaaattact cttactgtta cttcaaagga ccctgaaaga cctcctgttc atgaccaact tcaggaccca cgactgctga agaggatggg cattgaggtc aaaggaggaa tattcctttg ggatccacaa ccctcgagcc cccagcatcc tggagcaaca cctcctacgg gcgagccggg cttccctgtc gttcaccagg acctgagcca tatacagcag cccgctgctg tagtggctgc tctgagcagc cacaaacctc ccgtgcgggg cgaacctcca gctgccagtc ccgaggcttc cacgtgtcag agcaaatgtg atgacccgga agaggagctc tgtcacagga gagaggccag ggctttcagt gaaggggagc aggagaagtg tggttccgag acccatcaca ccaggaggaa ctctaggtgg gacaagagga cactggagca ggaggacagc agttccaaga aaagaaagct tttatag. It is sometimes possible for the material contained within the vial of "SETX, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.