Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PHF11 cdna clone

PHF11 cDNA Clone

Gene Names
PHF11; APY; BCAP; IGEL; IGER; IGHER; NYREN34; NY-REN-34
Synonyms
PHF11; PHF11 cDNA Clone; PHF11 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaaaaaggacatgtgcactctgccccaaagatgtcgaatataatgtcctgtactttgcacaatcagagaatatagctgctcatgagaattgtttgctgtattcttcaggacttgtggaatgtgaggatcaggatccacttaatcctgatagaagttttgatgtggaatcagtaaagaaagaaatccagagaggaaggaagttgaaatgcaaattttgtcataaaagaggagccaccgtgggatgtgatttaaaaaactgtaacaagaattaccactttttctgtgccaagaaggacgacgcagttccacagtctgatggagttcgaggaatttataaactgctttgccagcaacatgctcaattcccgatcatcgctcaaagtgctaaattttcaggagtgaaaagaaaaagaggaaggaagaaacccctctcaggcaatcatgtacagccacccgaaacaatgaaatgtaatacattcataagacaagtgaaagaagagcatggcagacacacagatgcaactgtgaaagttccttttcttaagaaatgcaaggaagcaggacttcttaattacttacttgaagaaatattagacaaagttcattcaattccagaaaaactcatggatgagactacttcagaatcagactatgaagaaatcgggagtgcactttttgactgtagattgttcgaagacacatttgtaaattttcaagcagcaatagagaaaaaaattcatgcatctcaacaaaggtggcagcagttgaaggaagagattgagctacttcaggacttaaaacaaaccttgtgctcttttcaagaaaatagagatcttatgtcaagttctacatcaatatcatccctgtcttattag
Sequence Length
879
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,499 Da
NCBI Official Full Name
Homo sapiens PHD finger protein 11, mRNA
NCBI Official Synonym Full Names
PHD finger protein 11
NCBI Official Symbol
PHF11
NCBI Official Synonym Symbols
APY; BCAP; IGEL; IGER; IGHER; NYREN34; NY-REN-34
NCBI Protein Information
PHD finger protein 11
UniProt Protein Name
PHD finger protein 11
Protein Family
UniProt Gene Name
PHF11
UniProt Synonym Gene Names
BCAP
UniProt Entry Name
PHF11_HUMAN

NCBI Description

This gene encodes a protein containing a PHD (plant homeodomain) type zinc finger. This gene has been identified in some studies as a candidate gene for asthma. Naturally-occurring readthrough transcription may occur from the upstream SETDB2 (SET domain bifurcated 2) gene to this locus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]

Uniprot Description

PHF11: Positive regulator of Th1-type cytokine gene expression. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 13q14.2

Disease: Asthma, Susceptibility To; Ige Responsiveness, Atopic

Research Articles on PHF11

Similar Products

Product Notes

The PHF11 phf11 (Catalog #AAA1270839) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaaaaa ggacatgtgc actctgcccc aaagatgtcg aatataatgt cctgtacttt gcacaatcag agaatatagc tgctcatgag aattgtttgc tgtattcttc aggacttgtg gaatgtgagg atcaggatcc acttaatcct gatagaagtt ttgatgtgga atcagtaaag aaagaaatcc agagaggaag gaagttgaaa tgcaaatttt gtcataaaag aggagccacc gtgggatgtg atttaaaaaa ctgtaacaag aattaccact ttttctgtgc caagaaggac gacgcagttc cacagtctga tggagttcga ggaatttata aactgctttg ccagcaacat gctcaattcc cgatcatcgc tcaaagtgct aaattttcag gagtgaaaag aaaaagagga aggaagaaac ccctctcagg caatcatgta cagccacccg aaacaatgaa atgtaataca ttcataagac aagtgaaaga agagcatggc agacacacag atgcaactgt gaaagttcct tttcttaaga aatgcaagga agcaggactt cttaattact tacttgaaga aatattagac aaagttcatt caattccaga aaaactcatg gatgagacta cttcagaatc agactatgaa gaaatcggga gtgcactttt tgactgtaga ttgttcgaag acacatttgt aaattttcaa gcagcaatag agaaaaaaat tcatgcatct caacaaaggt ggcagcagtt gaaggaagag attgagctac ttcaggactt aaaacaaacc ttgtgctctt ttcaagaaaa tagagatctt atgtcaagtt ctacatcaat atcatccctg tcttattag. It is sometimes possible for the material contained within the vial of "PHF11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.